Клей термекс: Штукатурно-клеевая смесь ЕК THERMEX MW/PPS

Содержание

Клей ЕК THERMEX

 Клей ЕК THERMEX используется для устройства систем скрепленной теплоизоляции внутри и снаружи зданий и помещений. Предназначен для крепления минераловатных (MW) и пенополистирольных (PPS) плит, а также для укладки армирующей стеклосетки на вертикальные и горизонтальные оштукатуренные, бетонные, кирпичные и другие минеральные основания, в том числе невпитывающие и эксплуатирующиеся в широком интервале температур внутри и снаружи зданий.

Для внутренних и наружных работ.

Особенности

  • Морозостойкость
  • Высокая адгезия к различным основаниям
  • Пластичность

Технические характеристики

Цвет серый
Вяжущее цемент
Максимальный размер зерна, мм 1.25
Время жизни раствора не менее, ч 3
Открытое время не менее, мин 15
Расход смеси при приклеивании материалов, кг/м² 5.5-6.5
Расход смеси при армировании поверхности, кг/м² 5.0-6.0
Толщина слоя, мм 3-8
Температура проведения работ, °С от +5 до +30
Адгезия к бетону не менее, МПа 1.0
Морозостойкость не менее, циклов 75
Температура эксплуатации, °С от -50 до +70
Срок годности в неповрежденной оригинальной упаковке 12 месяцев со дня изготовления

Инструкция

Подготовка основания

Основание должно быть крепким, тщательно очищенным от пыли, грязи, воска, масел, жиров, остатков неплотно прилегающей краски и других веществ, способных ослабить сцепление клеевого раствора с основанием. При приклеивании пенополистирольных и минераловатных плит неровности глубиной до 5 мм предварительного выравнивания не требуют. Перед проведением работ неравномерно или сильновпитывающие основания (газобетон, силикатный кирпич) необходимо обработать грунтовкой глубокого проникновения ЕК GS300 DEEP, ЕК GS300 TIEFENGRUND или ЕК GS400 ANTISEPTIC.

Приготовление раствора

Для приготовления клеевого раствора ЕК THERMEX необходимо:

  • Взять точно отмеренное количество воды (4.5-5.75 л на мешок 25 кг)
  • Высыпать смесь в воду
  • Перемешать при помощи строительного миксера или дрели со специальной насадкой
  • до получения однородной массы
  • Выдержать технологическую паузу 10 минут для созревания раствора
  • Перемешать повторно

После этого клей готов к применению в течение 3 часов при периодическом перемешивании.

Порядок проведения работ

При приклеивании теплоизоляционных материалов клеевой раствор ЕК THERMEX наносится порциями на внутреннюю поверхность плиты по периметру листа и в один-два ряда по центру. Интервал между порциями зависит от размера, толщины листа и неровности основания. После нанесения раствора плита прикладывается к основанию, а потом корректируется ее положение. Необходимо использовать такое количество раствора, чтобы после корректировки получить равномерное приклеивание плиты.

При укладке армирующей сетки для создания армированного слоя на изоляцию наносится раствор ЕК THERMEX толщиной слоя около 6 мм. На поверхность, подготовленную таким образом, помещают армированную сетку из стекловолокна и выполняют заглаживание шпателем.

Техника безопасности

Сухая смесь содержит цемент. При смешивании с водой продукт дает щелочную реакцию. Для предотвращения раздражения кожи избегать попадания раствора на открытые участки тела. При попадании в глаза немедленно промыть их водой, при необходимости обратиться к врачу. Кроме вышеизложенной информации, следует руководствоваться инструкциями по технике безопасности в строительстве.

 

Клей для минераловатных и пенополистирольных плит EK Thermex (25кг)

  • Клей для минераловатных и пенополистирольных плит EK THERMEX Термекс – это высокая адгезия к различным основаниям, пластичность и морозостойкость
  •  
Подготовка основания перед нанесением клея EK THERMEX Термекс
Основание должно быть крепким, тщательно очищенным от пыли, грязи, воска, масел, жиров, остатков неплотно прилегающей краски и других веществ, способных ослабить сцепление клеевого раствора с основанием. При приклеивании пенополистирольных и минераловатных плит неровности глубиной до 5 мм предварительного выравнивания не требуют. Перед проведением работ неравномерно или сильновпитывающие основания (газобетон, силикатный кирпич) необходимо обработать грунтовкой.
 
Приготовление клея фасадного Термекс EK THERMEX 
Для приготовления клеевого раствора EK THERMEX Термекс необходимо: 
  1. Взять точно отмеренное количество воды (5,3-6 л на мешок 25 кг)
  2. Высыпать смесь EK THERMEX в воду
  3. Перемешать при помощи строительного миксера или дрели со специальной насадкой до получения однородной массы
  4. Выдержать технологическую паузу 10 минут для созревания раствора и перемешать повторно
После этого клей EK THERMEX готов к применению в течение 3 часов при периодическом перемешивании. 
 
Порядок проведения работ 
При приклеивании теплоизоляционных материалов клеевой раствор EK THERMEX ЕК Термекс наносится порциями на внутреннюю поверхность плиты по периметру листа и в один-два ряда по центру. Интервал между порциями зависит от размера, толщины листа и неровности основания. После нанесения раствора EK THERMEX плита прикладывается к основанию, а потом корректируется ее положение. Необходимо использовать такое количество раствора EK THERMEX, чтобы после корректировки получить равномерное приклеивание плиты. При укладке армирующей сетки для создания армированного слоя на изоляцию наносится клей ЕК THERMEX толщиной слоя около 6 мм. На поверхность, подготовленную таким образом, помещают армированную сетку из стекловолокна и выполняют заглаживание шпателем. 
 
Техника безопасности

Сухая смесь EK THERMEX содержит цемент который при смешивании с водой дает щелочную реакцию и для предотвращения раздражения кожи необходимо избегать попадания раствора EK THERMEX на открытые участки тела. При попадании в глаза немедленно промыть их водой, при необходимости обратиться к врачу. Кроме вышеизложенной информации следует руководствоваться инструкциями по технике безопасности в строительстве. 

Технические характеристики клея EK THERMEX:

Цвет смеси: серый 

Вяжущее вещество клея: цемент

Максимальный размер зерна: 1,25 мм

Время жизни раствора не менее: 3 ч

Открытое время не менее: 15 минут

Расход смеси при приклеивании материалов: 5,5-6,5

 кг/м2

Расход смеси при армировании поверхности: 5,0-6,0 кг/м2

Толщина слоя: 3-8 мм

Температура проведения работ: от +5 до +30 

Адгезия к бетону не менее: 1 МПа

Температура эксплуатации: от -50 до +70

Морозостойкость: 75 циклов

Срок годности в неповрежденной оригинальной упаковке: 6 месяцев со дня изготовления

 
Гарантии и хранение
Срок годности клея EK THERMEX Термекс в неповрежденной оригинальной упаковке – 6 месяцев со дня изготовления. Хранить в сухих помещениях, исключающих попадание влаги на мешки с сухой смесью. Транспортировка продукции должна осуществляться в условиях, обеспечивающих сохранность упаковки и защиту от влаги. Производитель EK гарантирует соответствие качества клея THERMEX  требованиям технических условий – ТУ 5745-018-47532402-2005, но не несет ответственности за несоблюдение технологии работы с материалом, а также его применение в целях, не предусмотренных инструкцией. Инструкция по применению сухой смеси носит рекомендательный характер и не заменяет профессиональной подготовки исполнителя работ. При несоблюдении инструкций и рекомендаций по хранению и применению, производитель не несет ответственности за качество проведенных работ.

ТД Стройматериалы – ЕК THERMEX SYSTEM MW/PPS

  • Технические характеристики

    Цвет серый
    Вяжущее цемент
    Время жизни раствора не менее, ч 3
    Расход смеси при приклеивании материалов, кг/м² 5.5-6.5
    Расход смеси при армировании поверхности, кг/м² 5.0-6.0
    Толщина слоя, мм 3-8
    Температура проведения работ, °С от +5 до +30
    Адгезия к бетону не менее, МПа 0.5
    Адгезия к PPS не менее, МПа
    0.12
    Паропроницаемость не менее, мг/м*ч*Па 0.035
    Прочность на сжатие не менее, МПа 4.5
    Температура эксплуатации, °С от -50 до +80
    Морозостойкость не менее, циклов 75
    Срок годности в неповрежденной оригинальной упаковке 12 месяцев со дня изготовления
  • Инструкция

    Порядок проведения работ

    Основание должно быть крепким, тщательно очищенным от пыли, грязи, воска, масел, жиров, остатков неплотно прилегающей краски и других веществ, способных ослабить сцепление клеевого раствора с основанием. При приклеивании пенополистирольных и минераловатных плит неровности глубиной до 5 мм предварительного выравнивания не требуют. Перед проведением работ неравномерно или сильновпитывающие основания (газобетон, силикатный кирпич) необходимо обработать грунтовкой глубокого проникновения ЕК GS300 DEEP, ЕК GS300 TIEFENGRUND или ЕК GS400 ANTISEPTIC.

    Приготовление раствора

    Для приготовления клеевого раствора ЕК THERMEX System MW/PPS необходимо:

    • Взять точно отмеренное количество воды (5.3-6.0 л на мешок 25 кг)
    • Высыпать смесь в воду
    • Перемешать при помощи строительного миксера или дрели со специальной насадкой до получения однородной массы
    • Выдержать технологическую паузу 10 минут для созревания раствора
    • Перемешать повторно

    После этого клей готов к применению в течение 3 часов при периодическом перемешивании.

    Порядок проведения работ

    При приклеивании теплоизоляционных материалов клеевой раствор ЕК THERMEX System MW/PPS наносится порциями на внутреннюю поверхность плиты по периметру листа и в один-два ряда по центру. Интервал между порциями зависит от размера, толщины листа и неровности основания. После нанесения раствора плита прикладывается к основанию, а потом корректируется ее положение. Необходимо использовать такое количество раствора, чтобы после корректировки получить равномерное приклеивание плиты. После высыхания раствора (не ранее, чем через 3 суток) произвести механическое закрепление плит фасадными дюбелями.

    Работы по созданию защитного базового слоя проводятся в следующей последовательности:

    • на утеплитель с помощью зубчатого шпателя наносится клеевой состав ЕК THERMEX System MW/PPS толщиной 3-4 мм
    • на свежий клеевой состав укладывается армирующая сетка. Сетка утапливается в клеевой состав металлическим шпателем, далее наносится накрывочный слой. Запрещается укладывать армирующую сетку непосредственно на теплоизоляционный слой. Сетка должна располагаться внутри клеевого слоя и не просматриваться на его поверхности. Неровности на поверхности защитного базового слоя удаляются на следующий день после его создания. Высыхание базового слоя 72 часа.

    Рекомендуется все действия по монтажу производить согласно инструкции по монтажу системы наружной теплоизоляции стен зданий с тонким штукатурным слоем «EK System MW/PPS».

  • Техника безопасности

    Сухая смесь содержит цемент. При смешивании с водой продукт дает щелочную реакцию. Для предотвращения раздражения кожи избегать попадания раствора на открытые участки тела. При попадании в глаза немедленно промыть их водой, при необходимости обратиться к врачу. Кроме вышеизложенной информации, следует руководствоваться инструкциями по технике безопасности в строительстве.

  • Гарантии и хранение

    Срок годности в неповрежденной оригинальной упаковке – 12 месяцев со дня изготовления. Хранить в сухих помещениях, исключающих попадание влаги на мешки с сухой смесью. Производитель гарантирует соответствие качества продукта требованиям технических условий – ТУ 5745-032-47532402-2010, но не несет ответственности за несоблюдение технологии работы с материалом, а также его применение в целях, не предусмотренных инструкцией.

    Транспортировка продукции должна осуществляться в условиях, обеспечивающих сохранность упаковки и защиту от влаги.

    Инструкция по применению сухой смеси носит рекомендательный характер и не заменяет профессиональной подготовки исполнителя работ. При несоблюдении инструкций и рекомендаций по хранению и применению производитель не несет ответственности за качество проведенных работ.

  • Сертификаты

    Свидетельство о государственной регистрации

    Отказное письмо «Об обязательном подтверждении соответствия»

    Отказное письмо о соответствии требованиям пожарной безопасности

    Сертификат соответсвия ГОСТ Р 54359-2011

    Техническое свидетельство системы СУФ «EK System MW»

    Техническое свидетельство системы СУФ «EK System PPS»

    Техническая оценка системы СУФ «EK System MW»

    Техническая оценка системы СУФ «EK System PPS»

    Техническое описание

  • Набор монтажный THERMEX для установки водонагревателя 1/2′ без слива (

    Описание

    Набор монтажный THERMEX для установки водонагревателя 1/2′ без слива. Монтажные наборы для установки накопительных и проточных водонагревателей Thermex и других производителей с присоединительным размером патрубков 1/2. Упрощают установку, эксплуатацию и демонтаж техники. Возможность быстрого включения водонагревателя в систему водоснабжения и отключения из нее. Укомплектованы в фирменные блистеры. Анаэробный герметик в составе вместо фум-ленты, пасты и льна. Комплектующие набора из латуни 58. Рычаги кранов из высококачественной стали. Комплектация: Кран шаровый В-Н 1/2 – 2 шт., американка прямая 1/2 В-Н – 2 шт., клей-герметик анаэробный 310 FIX Press – 50 мл.

    Под заказ: доставка до 14 дней 1871 ₽

    В наличии 1871 ₽

    Характеристики

    • Размеры
    • Длина:

      254 мм

    • Ширина:

      146 мм

    • Высота:

      30 мм

    • Вес, объем
    • Вес нетто:

      0.5 кг

    • Другие параметры
    • Срок поставки в днях:

      14

    • Производитель:

    • Срок хранения(мес):

      24

    • Страна происхож.:

      Китай

    • Торговая марка:

    • Шт. в упаковке:

      1

    Характеристики

    Торговый дом “ВИМОС” осуществляет доставку строительных, отделочных материалов и хозяйственных товаров. Наш автопарк — это более 100 единиц транспортных стредств. На каждой базе разработана грамотная система логистики, которая позволяет доставить Ваш товар в оговоренные сроки. Наши специалисты смогут быстро и точно рассчитать стоимость доставки с учетом веса и габаритов груза, а также километража до места доставки.

    Заказ доставки осуществляется через наш колл-центр по телефону: +7 (812) 666-66-55 или при заказе товара с доставкой через интернет-магазин. Расчет стоимости доставки производится согласно тарифной сетке, представленной ниже. Точная стоимость доставки определяется после согласования заказа с вашим менеджером.

    Уважаемые покупатели! Правила возврата и обмена товаров, купленных через наш интернет-магазин регулируются Пользовательским соглашением и законодательством РФ.

    ВНИМАНИЕ! Обмен и возврат товара надлежащего качества возможен только в случае, если указанный товар не был в употреблении, сохранены его товарный вид, потребительские свойства, пломбы, фабричные ярлыки, упаковка.

    Доп. информация

    Цена, описание, изображение (включая цвет) и инструкции к товару Набор монтажный THERMEX для установки водонагревателя 1/2′ без слива ( на сайте носят информационный характер и не являются публичной офертой, определенной п.2 ст. 437 Гражданского кодекса Российской федерации. Они могут быть изменены производителем без предварительного уведомления и могут отличаться от описаний на сайте производителя и реальных характеристик товара. Для получения подробной информации о характеристиках данного товара обращайтесь к сотрудникам нашего отдела продаж или в Российское представительство данного товара, а также, пожалуйста, внимательно проверяйте товар при покупке.

    Купить Набор монтажный THERMEX для установки водонагревателя 1/2′ без слива ( в магазине Мурино вы можете в интернет-магазине “ВИМОС”.

    Статьи по теме

    Водонагреватель ТЕРМЕКС Drift 15U | Экономстрой

    Описание

    Водонагреватель аккумуляционный электрический бытовой THERMEX Drift 15 U

    Простой, доступный и надежный водонагреватель с удобным механическим управлением. Inox Cask отличается скромными габаритами, что делает его идеальным для установки под раковиной или над раковиной, а также в ванной комнате.

    Высокая надежность: внутренний бак из нержавеющей стали G.5 с защитой от коррозии обеспечивает стабильную и длительную работу нагревателя.

    Компактность: водонагреватель объемом 10 — 15 литров позволяет разместить водонагреватель даже в малогабаритных кухнях и ванных комнатах.

    Экономичность: индикатор режима работы ECO и теплоизоляционное покрытие для поддержания температуры воды.

    Широкие возможности установки: модели с верхним и нижним размещением патрубков.

    Удобное управление: простой механический регулятор для установки температуры.

    Безопасность: смонтированное на сетевом шнуре УЗО полностью защищает от поражения электрическим током.

    Тип водонагревателя накопительный

    Литраж, л 15

    Способ нагрева электрический

    Макс. мощность электрическая, Вт 1500

    Режимы мощности электрической, Вт 1500

    Напряжение сети, В 230

    Подключение к стандартной розетке да

    Установка вертикальная

    Подводка верхняя

    Способ крепления настенный/напольный

    Тип управления механическое

    Количество внутренних баков 1

    Материал внутреннего бака нержавеющая сталь

    Материал нагревательного элемента медь

    Сухой ТЭН нет

    Количество анодов 1

    Количество нагревательных элементов 1

    Время нагрева на ∆t 45°, мин 27

    Макс. давление воды, МПа 0.7

    Мин. давление воды, МПа 0.05

    Макс. температура нагрева воды, °С 75

    Присоединительный размер G1/2

    Ускоренный нагрев нет

    Тип электрического нагревательного элемента трубчатый

    Точки водоразбора несколько

    Класс IP IPX4

    УЗО да

    Защита от включения без воды нет

    Режим предотвращения замерзания нет

    Клапан предохранительный да

    Термометр нет

    Индикация включения да

    Индикация нагрева да

    Самодиагностика нет

    Пульт ДУ нет

    Дисплей нет

    Высота, мм 458

    Глубина, мм 260

    Ширина, мм 260

    Вес, кг 5.8

    Высота упаковки, мм 570

    Глубина упаковки, мм 330

    Ширина упаковки, мм 315

    Вес упаковки, кг 6.8

    Страна производитель Китай

    Гарантия на внутренний бак, мес 84

    Гарантия на изделие, мес 12

    Прайс

     

    ООО «СТРОЙГРАДЪ-НИЖНИЙ НОВГОРОД»

    603029 г. Н. Новгород, Ул. Памирская, д. 11s, оф. 55

    Тел./факс: 220-56-91, 89107909330

    ИНН 5258120213 КПП 525801001

    Р./сч. 40702810629120000343 в Филиал

    “Нижегородский” АО “АЛЬФА-БАНК”

    Кор. Счет 30101810200000000824 Бик 042202824

    Сайт.: http://stroygradnn.ru

        Тел./факс 8(831)220-56-91      Email: LVA[email protected]yandex.ru

     

    Коммерческое предложение

    7 Февраля 2017 г.

    Наименование товаров

                      цена

    (включая НДС)

    ЛАКИ, КРАСКИ, ПЕНЫ, ГЕРМЕТИКИ, КЛЕИ

    Грунты

    ЕК-КЕМИКАЛ

    Средство для защиты древесины и минеральных оснований ЕК UNIWOOD АНТИСЕПТ с цветным (розовым) маркером (10л)

    EK UNIWOOD АНТИСЕПТ для защиты древесины и минеральных оснований (5л)

    207.00 руб

    шт

    EK UNIWOOD АНТИСЕПТ для защиты древесины и минеральных оснований (10л)

    382.00 руб

    шт

    EK UNIWOOD Бактерицид для усиленной защиты древесины и минеральных оснований(5л)

    273.00 руб

    шт

    EK UNIWOOD Бактерицид для усиленной защиты древесины и минеральных оснований(10л)

    517.00 руб

    шт

    EK UNIWOOD БЕЛОЛЮКС для отбеливания древесины и обеззараживания мин.оснований (5л)

    174.00 руб

    шт

    EK UNIWOOD БЕЛОЛЮКС для отбеливания древесины и обеззараживания мин.оснований (10л)

    325.00 руб

    шт

    EK UNIWOOD универсальный ( 5л)

    282.00 руб

    шт

    EK UNIWOOD универсальный (10л)

    492.00 руб

    шт

    EK WOOD АНТИЖУК Средство для защиты древесины (5л)

    265.00 руб

    шт

    EK WOOD АНТИЖУК Средство для защиты древесины(10л)

    506.00 руб

    шт

    EK WOOD АНТИСЕПТ Средство для защиты древесины (5л)

    193.00 руб

    шт

    EK WOOD АНТИСЕП Средство для защиты древесины(10л)

    376.00 руб

    шт

    EK WOOD ОГНЕБИО ПЛЮС жидкая форма, средство для защиты древесины (5л)

    260.00 руб

    шт

    EK WOOD ОГНЕБИО ПЛЮС жидкая форма, средство для защиты древесины (10л)

    442.00 руб

    шт

    EK WOOD ОГНЕБИО Средство для защиты древесины (5л)

    234.00 руб

    шт

    EK WOOD ОГНЕБИО Средство для защиты древесины (10л)

    420.00 руб

    шт

    EK WOOD ОГНЕЗАЩИТА Средство для защиты древесины (5л)

    193.00 руб

    шт

    EK WOOD ОГНЕЗАЩИТА Средство для защиты древесины (10л)

    344.00 руб

    шт

    G100 ( 5л) вес

    шт

    Бетоноконтакт ЕК (6кг)

    387.00 руб

    шт

    Бетоноконтакт ЕК (14кг)

    807.00 руб

    шт

    Грунт EK G100 (5л)

    293.00 руб

    шт

    Грунт EK G100 (10л)

    538.00 руб

    шт

    Грунт EK G200 (5л)

    166.00 руб

    шт

    Грунт EK G200 (10л)

    317.00 руб

    шт

    Грунт ЕК GS300 DEEP (5л)

    224.00 руб

    шт

    Грунт ЕК GS300 DEEP (10л)

    416.00 руб

    шт

    Грунт ЕК GS300 DEEP (10л) FROST

    шт

    Грунт ЕК GS300 TIEFENGRUND ( 5л)

    236.00 руб

    шт

    Грунт ЕК GS300 TIEFENGRUND (10л)

    433.00 руб

    шт

    Грунт ЕК GS400 ANTISEPTIС (5л)

    250.00 руб

    шт

    Грунт ЕК GS400 ANTISEPTIС (10л)

    462.00 руб

    шт

    Грунт ЕК PlasterGrund (16кг)

    809.00 руб

    шт

    Пропитка EK WS100 WATER PROTECT (5л)

    216.00 руб

    шт

    Пропитка EK WS100 WATER PROTECT (10л)

    408.00 руб

    шт

    Пропитка для межплиточных швов ЕК WS100 (0,5л)

    69.00 руб

    шт

    СУХОЕ СТРОИТЕЛЬСТВО

    СУХИЕ СМЕСИ

    ЕК – КЕМИКАЛ

    GS300 DEEP (10л)

    шт

    TG20 ЕК Штукатурка гипсовая (30кг)

    шт

    TG40 White ЕК Штукатурка гипсовая (30кг)

    шт

    TG40 ЕК Штукатурка гипсовая (30кг)

    шт

    ЕК 1000 WIDE FROST Клей для плитки (25кг)

    222.00 руб

    шт

    ЕК 1000 WIDE Клей для плитки (25кг)

    166.00 руб

    меш

    ЕК 1000 WIDE Клей для плитки (5кг)

    51.00 руб

    меш

    ЕК 2000 KERAMIK FROST Клей плиточный зимний (25кг)

    244.00 руб

    шт

    ЕК 2000 Клей плиточный (5кг)

    62.00 руб

    меш

    ЕК 2000 Клей плиточный (25кг)

    183.00 руб

    меш

    ЕК 2000 Клей плиточный ECO (25кг)

    191.00 руб

    шт

    ЕК 3000 Клей плиточный (5кг)

    64.00 руб

    меш

    ЕК 3000 Клей плиточный (25кг)

    231.00 руб

    меш

    ЕК 3000 Клей плиточный ECO (25кг)

    249.00 руб

    шт

    ЕК 4000 TITAN Клей плит. керамогранит (25кг)

    355.00 руб

    меш

    ЕК 5000 AQUA Клей для бассейнов (25кг)

    368.00 руб

    меш

    ЕК 6000 MOZAIK Клей плиточный ( 5кг)

    104.00 руб

    шт

    ЕК 6000 MOZAIK Клей плиточный (20кг)

    370.00 руб

    шт

    ЕК 7000 GSB FROST Клей для ГСБ зимний (25кг)

    271.00 руб

    шт

    ЕК 7000 Смесь кладочно-клеевая ГСБ (25кг)

    218.00 руб

    меш

    ЕК 8000 KAMIN (25кг)

    374.00 руб

    шт

    ЕК COLOR BRICK белый

    197.00 руб

    шт

    ЕК DECOR System MW/PPS 1,2мм Штукатурка декоративная камешковая (25кг)

    шт

    ЕК DECOR System MW/PPS 1,5-2мм Штукатурка декоративная короед (25кг)

    шт

    ЕК DECOR System MW/PPS 2 – 2,5мм Штукатурка декоративная камешковая (25кг)

    453.00 руб

    шт

    ЕК DECOR System MW/PPS 2-2,5мм Штукатурка декоративная короед (25кг)

    355.00 руб

    шт

    ЕК DECOR Штукатурка декоративная (25кг)

    335.00 руб

    шт

    ЕК F100 Затирка для швов / античная роза 071 (2кг)

    169.00 руб

    шт

    ЕК F100 Затирка для швов / бежевая 002 (2кг)

    81.00 руб

    шт

    ЕК F100 Затирка для швов / белая 001 (2кг)

    81.00 руб

    шт

    ЕК F100 Затирка для швов / белая 001 (5кг)

    177.00 руб

    шт

    ЕК F100 Затирка для швов / белая 001 (20кг)

    644.00 руб

    шт

    ЕК F100 Затирка для швов / бирюзовый 052 (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / венге 043 (2кг)

    115.00 руб

    шт

    ЕК F100 Затирка для швов / голубая 005 (2кг)

    344.00 руб

    шт

    ЕК F100 Затирка для швов / желтая 009 (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / зеленая 006 (2кг)

    126.00 руб

    меш

    ЕК F100 Затирка для швов 021 / карамель (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / кирпичный 042 (2кг)

    104.00 руб

    шт

    ЕК F100 Затирка для швов / коралловый 073 (2кг)

    148.00 руб

    шт

    ЕК F100 Затирка для швов / коричневая 004 (2кг)

    104.00 руб

    шт

    ЕК F100 Затирка для швов / молочный 011 (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / морской волны 051 (2кг)

    360.00 руб

    шт

    ЕК F100 Затирка для швов / оливковый 062 (2кг)

    104.00 руб

    шт

    ЕК F100 Затирка для швов / ореховый 041 (2кг)

    104.00 руб

    шт

    ЕК F100 Затирка для швов / персиковая 092 (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / розовая 007 (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / светло-зеленый 061 (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / серая 003 (2кг)

    81.00 руб

    шт

    ЕК F100 Затирка для швов / серая 003 (5кг)

    177.00 руб

    шт

    ЕК F100 Затирка для швов / серая 003 (20кг)

    644.00 руб

    шт

    ЕК F100 Затирка для швов / серебристо серый (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / серо-бежевый 023 (2кг)

    104.00 руб

    шт

    ЕК F100 Затирка для швов / темно-серый 032 (2кг)

    92.00 руб

    шт

    ЕК F100 Затирка для швов / холодный розовый 072 (2кг)

    169.00 руб

    шт

    ЕК F100 Затирка для швов / черная 008 (2кг)

    92.00 руб

    меш

    ЕК F100 Затирка для швов / ярко-желтый 091 (2кг)

    92.00 руб

    шт

    ЕК F200 Затирка для широких швов (25кг) бежевая 102

    554.00 руб

    шт

    ЕК F200 Затирка для широких швов (25кг) Белая

    554.00 руб

    шт

    ЕК F200 Затирка для широких швов (25кг) серая

    554.00 руб

    шт

    ЕК FAST FIX Клей плиточный (25кг)

    281.00 руб

    меш

    ЕК FAST FIX Клей плиточный (5кг)

    74.00 руб

    шт

    ЕК FM02 OPTIMA Смесь для пола быстротверд (20кг)

    273.00 руб

    шт

    ЕК FS02 ECO Cмесь для пола (20кг)

    265.00 руб

    шт

    ЕК FT03 FINISH Финишный пол (20кг) НЕ ВЫПИСЫВАТЬ

    268.00 руб

    меш

    ЕК FT03 FINISH Финишный пол (23кг)

    380.00 руб

    шт

    ЕК FТ BASIS Cтяжка для пола (25кг)

    176.00 руб

    шт

    ЕК FТ01 BASE Cтяжка для пола (25кг)

    197.00 руб

    меш

    ЕК FТ02 MEDIUM Cмесь для пола (25кг)

    295.00 руб

    меш

    ЕК KR Шпатлевка полимерная ( 5кг)

    101.00 руб

    шт

    ЕК KR Шпатлевка полимерная (25кг)

    419.00 руб

    шт

    ЕК LR PLUS Шпатлевка полимерная (5кг)

    112.00 руб

    шт

    ЕК LR PLUS Шпатлевка полимерная (25кг)

    481.00 руб

    шт

    ЕК LR Шпатлевка полимерная (5кг)

    105.00 руб

    меш

    ЕК LR Шпатлевка полимерная (25кг)

    443.00 руб

    меш

    ЕК S500 Клей монтажный (30кг)

    276.00 руб

    шт

    ЕК THERMEX System MW Клей для минер. и пеноп. плит (25кг)

    379.00 руб

    шт

    ЕК THERMEX Клей для минер. и пеноп. плит (25кг)

    298.00 руб

    меш

    ЕК THERMEX Клей для мин.плит и пеноп. (20кг) !!!!!

    217.00 руб

    шт

    ЕК UniPlast 1,5-2 Штук. гот. Короед (25кг) RAL6019

    шт

    ЕК UniPlast 1.5-2.0 Штукат.гот.Камешк(25кг) S 3030-Y30R

    шт

    ЕК UniPlast 1.5-2.0 Штукат.гот.Камешк(25кг) S 4020-Y50R

    шт

    ЕК UniPlast 1.5-2.0 Штукат.гот.Камешк(25кг)рал 7005

    шт

    ЕК UniPlast 1.5-2.0 Штукат.гот.Камешк(25кг)рал 0500- N

    шт

    ЕК UniPlast 1.5-2.0 Штукат.гот.Камешк(25кг)рал1019

    шт

    ЕК UniPlast 1.5-2.0 Штукат.гот.Камешк(25кг)рал 8010-Y50R

    шт

    ЕК UniPlast 1.5-2.0 Штукат.гот.Короед (25кг) рал 1014

    шт

    ЕК UniPlast 1.5-2.0мм Штукатурка готовая Камешковая (25кг)

    шт

    ЕК UniPlast 2-2,5 Штук. гот. Короед (25кг) 0510Y20

    шт

    ЕК UniPlast 2,0-2,5мм Штукатурка готовая Короед (25кг) RAL1034

    шт

    ЕК UniPlast 2-2,5 Штук.гот.Камешковая (25кг) RAL1034

    шт

    ЕК UniPlast 2,0-2,5мм Штукатурка готовая Камешковая (25кг)

    шт

    ЕК UniPlast 2,0-2,5мм Штукатурка готовая Короед (25кг)

    шт

    ЕК Vh40 Шпатлевка фасадная серая (20кг)

    261.00 руб

    меш

    ЕК VH80 Шпатлевка фасадная белая (20кг)

    329.00 руб

    меш

    ЕК W400 Смесь гидроизолирующая (15кг)

    411.00 руб

    шт

    ЕК готовая шпаклевка мультификс (1,5кг)

    шт

    ЕК К200 Шпатлевка гипсовая (25кг)

    325.00 руб

    меш

    ЕК К300 Шпатлевка гипсовая (25кг)

    358.00 руб

    меш

    ЕК К300 шпатлевка улучшенная (3кг)

    76.00 руб

    меш

    ЕК К500 Шпатлевка (3кг)

    91.00 руб

    меш

    ЕК К500 Шпатлевка гипсовая (25кг)

    457.00 руб

    меш

    ЕК Раствор кладочный (30кг)

    198.00 руб

    шт

    EK TG100 Штукатурка гипсовая (30кг)

    259.00 руб

    меш

    ЕК ТG20 Штукатурка гипсовая (30кг)

    259.00 руб

    меш

    ЕК ТG40 White Штукатурка гипсовая (5кг)

    74.00 руб

    шт

    ЕК ТG40 White Штукатурка гипсовая (15кг)

    167.00 руб

    меш

    ЕК ТG40 White Штукатурка гипсовая (30кг)

    300.00 руб

    меш

    ЕК ТG40 Штукатурка гипсовая (30кг)

    287.00 руб

    меш

    ЕК ТG50 Штукатурка гипсовая (30кг)

    280.00 руб

    меш

    ЕК ТТ100 FASAD Штукатурка цементная (23кг)

    201.00 руб

    шт

    ЕК ТТ100 INSIDE Штукатурка цементная (25кг)

    174.00 руб

    шт

    ЕК ТТ30 Штукатурка цементная (25кг)

    175.00 руб

    меш

    ЕК ТТ50 Штукатурка цементная (25кг)

    214.00 руб

    шт

    ЕКМ-400 (Смесь для пола, 25 кг)

    шт

    ЕКМ-500 /Смесь для пола/ 25кг.

    шт

    Клей для плитки KERAMIK “ЕК”25кг

    шт

    ЕК 1000 WIDE Клей для плитки (25кг)

    шт

    ЕК 1000 WIDE FROSTКлей для плитки (25кг)

    шт

    Клей для теплоизоляции ек thermex | Festima.Ru

    химстойка краска для металла ХС 759 20+0,4кг Здравствуйте! 💼 Мы – компания «Мицар». Мы с 2008 года производим и поставляем на рынок лакокрасочные материалы, клея, строительную и промышленную химию по оригинальным рецептурам и техническим условиям под собственными брендами: Mitsar (Мицар), Akromat (Акромат), Rezolux (Резолюкс), Akropur (Акропур), Akrep (Акрэп), Antiks (Антикс). «Мицар» — это сервис удобных и выгодных покупок: — 📍 огромный выбор красок, лаков, эмалей для любых поверхностей — 📍 продукция реализуется как в розницу, так и оптом; — 📍 предусмотрен наличный и безналичный расчет; — 📍 товары нашего лакокрасочного завода и партнеров всегда есть на складе; — 📍 организована оперативная доставка заказов; — 📍 товар могут приобрести жители разных городов России. Покупателям доступна услуга колеровки лакокрасочных материалов. В нашем офисе можно оценить образцы и задать вопросы специалисту, в том числе по выбору продукции. 📞 📩 Звоните и пишите нам, мы оперативно ответим на все вопросы и поможем выбрать, ведь у нас огромный ассортимент и все есть в наличии. *Цена в объявлении указана за 1кг Возможно вы искали: Краска эпоксидная для бетонных полов, Краска, Грунт-эмаль по ржавчине термостойкая, Краска для бетонных полов износостойкая, Краска, Грунт-эмаль по ржавчине, Краска, Грунт-эмаль корабельная, Лак термостойкий, Краска, Эмаль термостойкая, Краска в/д Интерьерная, Краска в/д Интерьерная, Краска для дорожной разметки, Краска, Грунт-Эмаль по ржавчине, Краска, Грунт-Эмаль по ржавчине, Краска в/д фасадная, Краска, компаунд для бетонных полов полимерная, Краска моющаяся не горючая, Краска огнезащитная, Грунт для бетонных полов, Краска для бетонных полов износостойкая, Краска фасадная, Краска серебрянка, Краска, Эмаль фасадная, Краска, Эмаль по металлу, Краска, Эмаль по металлу, Краска фасадная, Краска, Эмаль защитная для военной техники, Краска, Эмаль химстойкая, Грунт защитный для металла, Краска, Эмаль судовая, Краска в/д для мед и детских учреждений, Краска, Эмаль для полов без запаха, Краска резиновая, Краска резиновая, Краска резиновая, Пропитка водоотталкивающая, Краска для бетонных полов полиуретановая, Холодный пластик, Стеклошарики Характеристики: Укрывистость (г/м2): 215 Устойчивость (мкм): 15 Перетир (мкм): 290

    Ремонт и строительство

    Как детский клей решает загадку многолетней давности

    Трансплантация костного мозга и стволовых клеток стала спасительным методом лечения для миллионов пациентов, страдающих гематологическими заболеваниями и раком (1). Долговременная репопуляция гемопоэтических стволовых клеток (LT-HSCs) в трансплантате донора способствует пожизненному восстановлению клеток крови у реципиента (2). LT-HSC представляют собой мультипотентные взрослые стволовые клетки, способные регенерировать все линии клеток крови (3). Их собирают из костного мозга взрослых и пуповинной крови, а также из периферической крови после мобилизации из костного мозга.В то время как трансплантация стволовых клеток стала ярким примером успешной клеточной терапии и регенеративной медицины, режим лечения по-прежнему сталкивается с рядом проблем. Во-первых, при аллогенной трансплантации трансплантата от неродственного донора необходимо идентифицировать HLA-совместимого донора и избегать тяжелых реакций «трансплантат против хозяина». Это требует огромных материально-технических и финансовых усилий и в основном охватывает только HLA-гаплотипы крупных этнических групп. Во-вторых, на быстрое восстановление клеток крови влияет количество функциональных стволовых клеток в трансплантате.Особенно в пуповинной крови, источнике очень мощных LT-HSCs, количество стволовых клеток недостаточно для взрослого реципиента, и единицы пуповинной крови от нескольких доноров должны быть объединены. В-третьих, подходы генной терапии требуют нескольких дней культивирования in vitro для генетической репарации мутаций в LT-HSC пациентов с наследственными гематологическими заболеваниями, а активность LT-HSC быстро и последовательно снижается с течением времени. Кроме того, количество репарированных LT-HSC определяет успех лечения, особенно при заболеваниях, при которых коррекция гена не дает избирательного преимущества репарированным LT-HSC.

    LT-HSC находятся в костном мозге в состоянии глубокого покоя, поэтому они не участвуют в клеточном цикле и редко делятся в течение жизни (4). Микроокружение в нише костного мозга представляется жизненно важным для сохранения биологии LT-HSCs с их особыми метаболическими свойствами (5,6). Хотя проспективное выделение LT-HSCs из костного мозга или пуповинной крови с использованием множественных поверхностных маркеров посредством сортировки клеток на основе проточной цитометрии было установлено в течение нескольких десятилетий (7,8), поддержание LT-HSCs в культуре in vitro до сих пор не достигнуто (9).После извлечения из своей экологической ниши в костном мозге и взятия в культуру LT-HSCs спонтанно и немедленно начинают дифференцироваться и последовательно теряют свой потенциал стволовых клеток в течение нескольких дней (10). Когда LT-HSC делятся, они либо самообновляются, чтобы сохранить свою идентичность стволовых клеток, либо дифференцируются, что приводит к образованию всех линий клеток крови. Очевидно, что экспансия LT-HSC требует обширных самообновляющихся подразделений. С момента экспериментальной идентификации стволовых клеток крови/клеток-предшественников в 1960-х годах (11) определение условий культивирования клеток для поддержания и размножения LT-HSCs стало поиском святого Грааля.До сих пор все протоколы, о которых сообщалось, не смогли воспроизводимо и надежно достичь размножения LT-HSCs с полным потенциалом восстановления клеток крови или обеспечили лишь незначительное преимущество по сравнению с существующими условиями (12). Тем не менее, во всем мире предпринимаются огромные усилия по поиску этих оптимальных условий.

    Теперь Адам Уилкинсон и соавторы из лаборатории Накаучи Стэнфордского университета в сотрудничестве с Токийским университетом (Сатоши Ямадзаки) сообщили, что они разгадали загадку (13).Они систематически проверяли и улучшали предыдущие условия культивирования и рационально изменяли факторы в соответствии с текущими знаниями о поведении LT-HSC. Чтобы считывать увеличенное количество LT-HSC и/или повышенную эффективность, авторы пошли на громоздкий, но в конечном итоге необходимый способ долгосрочных конкурентных анализов репопуляции крови у мышей-реципиентов. Они описывают поразительное увеличение чистого количества LT-HSC от 50 свежевыделенных мышиных LT-HSC до 12 000 LT-HSC через 28 дней в культуре. Они показали, что количество LT-HSC может быть дополнительно увеличено за 57 дней культивирования, и что культивированные LT-HSC очень эффективны даже для приживления необлученных реципиентов.Снижая концентрацию цитокинов фактора стволовых клеток (SCF) до 10 нг/мл в бессывороточной среде, они могли предотвратить чрезмерную интернализацию c-Kit, наблюдаемую при более высоких концентрациях. Во время культивирования in vitro LT-HSCs дифференцируются в клетки крови различных стадий дифференцировки и происхождения, которые продуцируют паракринные растворимые факторы (например, цитокины, хемокины) и обеспечивают межклеточные взаимодействия, влияющие на оставшийся незрелый пул LT-HSCs. В прошлом было показано, что непрерывная замена среды для истощения этих факторов, индуцирующих дифференцировку, полезна для пролонгированных культур LT-HSC (14).Опять же, авторы здесь использовали простой полный обмен среды каждые три дня, что доказало свое превосходство над обменом половины среды в отношении поддержания трансплантируемых репопуляционных LT-HSC. Использование планшетов, покрытых фибронектином, еще больше повысило активность культивируемых LT-HSC в восстановлении клеток крови по сравнению с пластиком, обработанным клеточной культурой, или покрытием из коллагена и желатина. Удивительно, но они обнаружили, что человеческий сывороточный альбумин (HSA), который добавляется в большинство бессывороточных сред, оказывает пагубное влияние на поддержание стволовых клеток.Они протестировали одиннадцать других заменителей альбумина, которые, как сообщается, поддерживают различные клеточные культуры, и обнаружили, что поливиниловый спирт (ПВС), который является основным компонентом клея для детей, может надежно заменить ЧСА. LT-HSCs, культивированные в бессывороточной среде с PVA вместо HSA, продемонстрировали четырехкратное увеличение восстановления крови у первичных реципиентных мышей и высокий и стабильный химеризм клеток крови у вторичных реципиентов, тогда как LT-HSCs, культивированные в среде, содержащей HSA, показали последовательное снижение химеризма клеток крови у первичных реципиентов и полностью не удалось значительно восстановить вторичных реципиентов.

    Сочетая все эти улучшенные условия культивирования, авторы впечатляюще продемонстрировали 50-200-кратное чистое увеличение мышиных LT-HSC с долгосрочным потенциалом восстановления крови на 28-й день культивирования. Отдельные культуры LT-HSC дополнительно продемонстрировали реальное распространение LT-HSC (самовосстановление), хотя и с различной эффективностью. Наиболее примечательно то, что количество и активность расширенных LT-HSC in vitro обеспечили надежное приживление и восстановление крови у некондиционированных мышей-реципиентов, достижение, недостижимое при использовании эквивалентных свежих LT-HSC.Авторы кратко описали преимущества своих улучшенных условий культивирования также для долгосрочного культивирования и размножения HSC человека, что они задокументировали в первых экспериментах. Тем не менее, общая применимость человеческих HSC ожидает будущих расширенных исследований. Усовершенствованные условия культивирования, описанные Wilkinson et al. . не требуют сложных систем совместного культивирования с фидерными клетками, генетических манипуляций или передовых технических устройств. Все компоненты могут поставляться в соответствии с надлежащей производственной практикой (GMP) для быстрого перевода в клиническое применение.

    Авторы приводят некоторые молекулярные объяснения, почему их улучшенные условия намного лучше, чем в предыдущих протоколах. Однако механизм взаимодействия различных факторов для усиления самообновления LT-HSCs остается неясным. Несмотря на кажущуюся простоту протокола клеточных культур, его надежность требует дальнейшего подтверждения другими группами, чтобы стать новым стандартом в этой области. Другие протоколы размножения HSC человека с использованием низкомолекулярных ингибиторов, таких как StemRegenin 1 (SR1) (15), UM171 (16) и вальпроевая кислота (VPA) (17, 18), а также биологических препаратов, таких как простагландин E2 (19, 20), или Инсулин-фактор роста-2 и ангиопоэтин-1 (21) прошли клинические испытания, и ожидаются результаты их полезного применения в медицине.Будет интересно посмотреть, будут ли некоторые из этих небольших молекул еще больше усиливать описанные эффекты в сочетании с улучшенными условиями. Как достигается чистое расширение LT-HSC? На уровне одного LT-HSC будет интересно посмотреть, действительно ли LT-HSC делятся так же быстро, как и нижележащие предшественники в этих условиях культивирования, но сохраняют ли они свой потенциал стволовых клеток, и делятся ли они более симметрично с образованием двух стволовых клеток. Кроме того, остается неясным, увеличивается ли пул LT-HSC только в первые дни улучшенной культуры in vitro , и после этого LT-HSC вступают в состояние покоя.В качестве альтернативы время генерации LT-HSC может быть длительным, но постоянным в течение всей 57-дневной культуры. Авторы тщательно протестировали способность размноженных LT-HSCs восстанавливать кровь. Однако остаются вопросы о молекулярных и метаболических свойствах этих LT-HSC. Являются ли эти LT-HSC одинаково эффективными при восстановлении нескольких линий при межклеточном сравнении со свежевыделенными LT-HSC? Напоминают ли расширенные LT-HSC профиль экспрессии генов свежевыделенных покоящихся или активированных LT-HSC (22)? Сохраняются ли генетические и эпигенетические профили этих LT-HSC в течение всего периода культивирования, учитывая, что деления LT-HSC могут вызывать нестабильность генома (23)? В будущем необходимо решить много вопросов, чтобы закрепить эти захватывающие результаты для достижения долгожданной цели — экспансии LT-HSC человека в культуре.

    Длительное размножение гемопоэтических стволовых клеток ex vivo позволяет проводить некондиционированную трансплантацию

    Мультипотентные самообновляющиеся гемопоэтические стволовые клетки (ГСК) регенерируют систему крови взрослых после трансплантации 1 . Несмотря на то, что были предприняты значительные усилия для определения факторов поддержания HSC посредством характеристики микроокружения или ниши in vivo HSC костного мозга (BM) 3–5 , стабильное распространение ex vivo HSC было недостижимым 6,7 .Здесь мы описываем разработку определенной, свободной от альбумина системы культивирования, которая поддерживает долгосрочное расширение функциональных HSCs. Благодаря систематической оптимизации мы обнаружили, что высокий уровень тромбопоэтина (ТПО) синергизирует с низким уровнем фактора стволовых клеток (SCF) и фибронектина для поддержания самообновления HSC. Кроме того, мы идентифицировали поливиниловый спирт (ПВС) как функционально превосходную, совместимую с Надлежащей производственной практикой (GMP) замену сывороточного альбумина, который долгое время был основным источником биологических загрязнителей в культурах HSC 8 .Эти условия обеспечивают от 236 до 899-кратную экспансию функциональных HSC в течение 1 месяца, хотя анализ клонально полученных культур предполагает значительную гетерогенность в способности ex vivo HSC к самообновлению. Используя эту систему, культуры HSC получены всего из 50 клеток, прочно привитых реципиентам без обычной потребности в токсическом предварительном кондиционировании (например, облучении), что предлагает новые подходы к трансплантации HSC. Таким образом, эти результаты имеют важное значение как для фундаментальных исследований HSC, так и для клинической гематологии.

    Для оптимизации культур HSC мы сначала титровали ТПО против SCF в 7-дневных культурах CD34 cKit + Sca1 + Lin (CD34 KSL) HSC (,), и определяли последствия путем конкурентной трансплантации летально облученным мышам-реципиентам против 1×10 6 клеток-конкурентов КМ. Самый высокий 16-недельный химеризм периферической крови (PB) (~30%) наблюдался при 100 нг/мл ТПО и 10 нг/мл SCF (1), возможно, из-за повышенной интернализации cKit при более высоких концентрациях SCF, что вызывало потерю чувствительности к SCF ( ,).

    Высокий уровень ТПО синергизирует с низким уровнем SCF и фибронектина для усиления размножения HSC

    (a) Средний 16-недельный химеризм донорских PB из 50 CD34 KSL HSC после 7-дневного культивирования в мышином TPO (1–100 нг/мл) ) и SCF мыши (1–100 нг/мл), как описано в . Конкурентная трансплантация против 1×10 6 BM конкурентов.

    (б) номер ячейки, полученный из 50 CD34 KSL, 50 CD34 + CD34 KSL, 50 CD150 CD34 KSL CD34 + KSL, или 50 CKIT + SCA1 Lin Клетки КМ после 7-дневного культивирования в 100 нг/мл ТПО и 10 нг/мл СКФ.Статистическая значимость рассчитана с использованием ANOVA. *** обозначает р=0,004, а **** обозначает р<0,0001. Среднее значение ± стандартное отклонение из 4 независимых культур.

    (c) 28-дневный рост 50 CD34 KSL HSC в 100 нг/мл ТПО и 10 нг/мл SCF, а также при половинной или полной смене среды (МС) каждые 3 дня. Среднее значение ± стандартное отклонение из 4 независимых культур.

    (d) Химеризм донорских PB у мышей-реципиентов из 1×10 4 клеток, полученных из HSC (~1 исходный эквивалент HSC; ~1 HSCeq) после 28-дневного культивирования (начиная с 50 CD34 KSL), как описано в ( c ).Конкурентная трансплантация против 1×10 6 BM конкурентов. Донорский PB-химеризм на 4-24 неделе у первичных реципиентов ( слева ) и на 4-12 неделе у вторичных реципиентов ( справа ).

    (e) 16-недельный донорский PB-химеризм из 1×10 4 клеток, полученных из HSC (1,25 HSCeq), после 28-дневного культивирования (начиная с 50 CD34 KSL) на пластике (n=5) или планшеты с фибронектином (n=3), культивированные в 100 нг/мл TPO и 10 нг/мл SCF с полной заменой среды. Конкурентная трансплантация против 1×10 6 BM конкурентов.Каждый столбец представляет отдельную мышь. Статистическая значимость рассчитана с использованием непарного двустороннего t-критерия. **** означает p<0,0001.

    В условиях 100 нг/мл ТПО и 10 нг/мл SCF преимущественно индуцируется пролиферация клеток-предшественников CD150 + CD34 KSL, полученных из костного мозга, а не гемопоэтических клеток-предшественников CD34, полученных из костного мозга + KSL (HPCs) ). Поэтому мы определили, возможна ли долгосрочная экспансия ex vivo HSC путем попытки культивирования в течение 1 месяца.Поскольку 50 исходных HSC размножались примерно в 13 000 раз во время культивирования (), мы трансплантировали 1×10 4 клеток на реципиента, примерно 1/50 th культуры или ~1 исходный эквивалент HSC (называемый ~1 HSCeq). Используя изменения половинной среды, мы обнаружили только кратковременное восстановление (). Однако, выполняя полную замену среды в культурах HSC, мы достигли аналогичного клеточного размножения, но также поддерживали долгосрочную активность HSC от ~ 1 HSCeq (1 × 10 4 клеток) (,).

    Учитывая необходимость полной смены среды во время культивирования, мы предположили, что прикрепление HSC-планшета может помочь сохранить HSC во время смены среды.Из 5 протестированных покрытий пластин фибронектин больше всего улучшал 16-недельный химеризм PB (). Хотя пролиферация HSC была сходной с фибронектином (), 1×10 4 клеток (1,25 HSCeq) из культур фибронектина на 28-й день давали почти 100% химеризм PB через 16 недель (). Это согласуется с недавними предположениями, что фибронектин является нишевым фактором BM 9 и передача сигналов фибронектина улучшает поддержание HSC 10,11 .

    Подобно культурам человеческих гемопоэтических стволовых клеток/клеток-предшественников (HSPC) 12 , несколько цитокинов и хемокинов (например,грамм. IL-6 и Ccl2–4) были в изобилии в культурах на 14-й день (, ) и предполагали механизмы контаминации HPC (всего 3 нг/мл IL-6 усиливали пролиферацию ex vivo CD34 + KSL HPC; ). Профиль секреции также предполагал активацию врожденного иммунного ответа 13 . В соответствии с этой идеей, секреция цитокинов снижалась при использовании TLR4 -/- HSC или при добавлении дексаметазона (,). Кондиционированные среды также индуцировали потерю активности HSC, предполагая, что факторы, индуцирующие дифференцировку, были растворимыми (1).

    Поливиниловый спирт может заменить сывороточный альбумин для размножения HSC ex vivo

    (a) Тепловая карта, показывающая кратность изменения средней интенсивности флуоресценции (MFI) иммуноанализа цитокинов с использованием кондиционированных сред для культур HSC на 7 и 14 день. Среднее значение для 4 независимых культур с кратностью изменения по сравнению с некондиционированной средой.

    (b) Клеточная экспансия 50 CD34 KSL HSC после семидневного культивирования в условиях без сывороточного альбумина, дополненного различными потенциальными химически определенными заменителями сывороточного альбумина (подробности см. в разделе «Методы»).Рекомбинантный человеческий сывороточный альбумин (HSA) использовали в качестве положительного контроля. Среднее значение ± стандартное отклонение из 3 независимых культур. ND означает не обнаружено.

    (c) Средний химеризм донорских PB у первичных реципиентов (n=5 в группе) и вторичных реципиентов (n=4 в группе) из 50 CD34 KSL HSC после 7-дневного культивирования в HSA-основанном или PVA- на основе среды, дополненной 100 нг/мл TPO и 10 нг/мл SCF в планшетах с U-образным дном. Конкурентная трансплантация против 1×10 6 конкурентов BM первичным реципиентам.Статистическая значимость рассчитана с использованием ANOVA. **** означает p<0,0001, н.с. означает статистически незначимое.

    (d) 7-дневная экспансия 50 CD150 + CD34 ГСК KSL в среде, содержащей 87%-гидролизованный ПВС (87%-ПВС) или >99%-гидролизованный ПВС (99%-ПВС). Среднее значение ± стандартное отклонение из 3 независимых культур. Статистическая значимость рассчитана с использованием t-критерия. *** обозначает р=0,0021.

    (e) 16-недельный химеризм донорских ПВ из 1×10 4 клеток из 28-дневных культур 87%-ПВС (n=3) и 99%-ПВС (n=4) (см. 28-дневные количество клеток).Каждый столбец представляет отдельную мышь.

    (f) 7-дневная экспансия 50 CD34, полученных из пуповинной крови человека + CD38 CD90 + CD49f + HSC в культурах на основе HSA или PVA с добавлением 10 нг/мл человеческого SCF и 100 нг/мл ТПО человека. Среднее значение ± стандартное отклонение из 3 независимых культур.

    (g) Средний 16-недельный химеризм CD45 человека + PB у сублетально облученных мышей NOG (n=5 в группе) после трансплантации 7-дневных культур, полученных из 2×10 3 CD34 + клеток .Статистическая значимость рассчитана с использованием ANOVA. ** обозначает р=0,0098. нс означает статистически незначимое.

    В наших культурах HSC использовался полученный из дрожжей рекомбинантный человеческий сывороточный альбумин (HSA). Мы предположили, что рекомбинантные белковые примеси могут быть причиной воспалительного фенотипа 14,15 , и искали замену HSA. Сывороточный альбумин может иметь несколько возможных функций в культурах HSC, в том числе как «молекула-носитель» или как источник аминокислот. Поскольку HSC не растут в средах с низким содержанием аминокислот, содержащих альбумин 16,17 , мы сосредоточились на замене функции молекулы-носителя.Из 11 проверенных химически синтезированных потенциальных заменителей (см. Методы для списка химических веществ) только поливиниловый спирт (ПВС) обеспечивает выживаемость, рост и поддержание фенотипа ГСК (, ). Кроме того, HSC, культивированные PVA, превосходили HSC, культивируемые HSA, в конкурентных тестах на трансплантацию. Мы также наблюдали значительно более низкие концентрации секретируемых факторов в ПВА-культурах (). Ассоциированная со старением экспрессия генов 18,19 ( p16Ink4a , p19Arf и Trp53 ) также снижалась в ПВС-культурах и накапливалась гамма-гистон 2А.X фосфорилирование 20 не обнаружено (,). В соответствии с ролью TLR4 в фенотипе HSA, добавление липополисахарида TLR4-агониста к PVA-культурам вызывало аналогичную индукцию p16 и p19 , а также секрецию IL-6 ().

    Хотя ПВА использовался для культивирования эмбриональных клеток 21,22 , его механистическая роль до сих пор плохо изучена. Чтобы исследовать свойства ПВС, которые позволяют ему действовать как заменитель альбумина, мы сравнили состояния гидролиза ПВС.В нашем первоначальном скрининге использовался 87%-ный гидролизованный ПВС (87%-ПВС), амфифильный полимер, содержащий домены ацетата и спирта. Напротив, в >99%-гидролизованном ПВС (99%-ПВС) отсутствуют ацетатные домены. ГСК выживали в средах, содержащих любой ПВС, но пролиферация была в 5 раз меньше в культурах с 99% ПВС (, ). Однако конкурентная трансплантация 1×10 4 клеток из культур 87%-PVA и 99%-PVA на 28-й день продемонстрировала, что оба типа PVA поддерживают HSC ex vivo ().

    В качестве недорогого, но совместимого с GMP заменителя альбумина, PVA также может иметь важные последствия для роста HSC человека.В качестве доказательства концепции мы подтвердили, что PVA может заменить сывороточный альбумин в культурах CD34 + HSPC, полученных из пуповинной крови человека (). Однако человеческие CD34 + CD38 CD90 + CD49f + HSC пролиферировали одинаково в 87%-PVA и 99%-PVA (), предполагая, что, в отличие от мыши, пролиферация HSC человека не была чувствительна к амфифильному PVA. Оба типа PVA могут поддерживать функциональную активность HSC ex vivo ().

    Исходя из приведенных выше результатов, мы определили оптимальные условия культивирования HSC мыши как 100 нг/мл TPO, 10 нг/мл SCF и 87%-PVA на фибронектине ().В этих условиях 50 CD150 + CD34 HSC KSL размножались примерно в 8000 раз за 28 дней (). В анализе предельных разведений (LDA) 28-дневных культур (трансплантированных против 2×10 5 BM-конкурентов) только 50 аликвот клеток демонстрировали >1% многолинейного химеризма PB через 16 недель у 2 из 3 реципиентов (,). С помощью анализа предельного разведения 23 мы рассчитали частоту HSC при 1:34,3 клеток, что эквивалентно 1,2×10 4 функциональных HSC в 28-дневной культуре ().Это сопоставимо с частотой 1:3,8 функциональных ГСК в свежеизолированной популяции CD150 + CD34 KSL (на основе данных о предыдущих трансплантациях 24 ). Таким образом, мы оцениваем расширение функциональных HSCs между 236-кратным (при условии, что все 50 исходных клеток были функциональными HSC) и 899-кратным (при условии, что исходные клетки 1: 3,8 [~ 13 клеток] были функциональными HSC).

    Длительное размножение функциональных ГСК ex vivo

    (а) Схема оптимизированной культуры размножения ГСК мыши: 50 CD150 + CD34 ГСК KSL сортировали в лунки планшета с плоским дном, покрытые фибронектином, содержащие альбумин- свободная среда F12 с добавлением 1 мг/мл ПВС, 100 нг/мл ТПО и 10 нг/мл СКФ.

    (b) Среднее количество живых клеток после культивирования 50 CD150 + CD34 ГСК KSL в течение 28 дней (n=6) или 57 дней (n=3) на планшетах, покрытых фибронектином, в культуральной среде на основе ПВС . Столбики погрешностей обозначают sd.

    (c) Блочные диаграммы, представляющие анализ предельных разведений свежих CD150 + CD34 KSL (всего 138 мышей; опубликовано ранее 24,25 ) и 28-дневных культур HSC (всего 16 мышей; см.) рассчитано с помощью программного обеспечения ELDA 23 с использованием положительного порога >1% многолинейного химеризма PB через 16 недель.Прямоугольные диаграммы обозначают рассчитанное среднее значение, а также верхний и нижний пределы.

    (d) 12-недельный донорский PB-химеризм у мышей-вторичных реципиентов (n=5 на группу), из 100 и 50 донорских клеток из 28-дневных культур PVA (с использованием первичных реципиентов в ). BM от трех первичных реципиентов объединяли и 1×10 6 клеток трансплантировали вторичным реципиентам. Каждый столбец представляет отдельную мышь.

    (e) Средний процент клеток фенотипической линии , KSL и CD150 + KSL во время культивирования, как описано в ( a ), на 7-й день (n=4), 14-й день (n=4) , 21-й день (n=4), 28-й день (n=6) и 57-й день (n=3).Столбики погрешностей обозначают sd.

    (f) Схема анализа размножения одиночных HSC: одиночные CD150 + CD34 KSL HSC размножали в течение 28 дней, а затем трансплантировали пяти летально облученным мышам-реципиентам против 5×10 5 BM конкурентов. Единичные HSC расширились до ~5×10 5 клеток, что означает, что каждый реципиент получил ~1×10 5 клеток (0,2 HSCeq). Было пересажено 10 отдельных культур, происходящих из HSC.

    (g) 16-недельный донорский PB-химеризм из 1/5 28-дневной культуры, полученной из одного CD150 + CD34 KSL HSC (n=5), как описано в ( f ).Каждый столбец представляет отдельную мышь. Репрезентативные данные для 3 независимых одиночных культур HSC (из 10 трансплантированных).

    Вторичная трансплантация проводилась путем объединения костного мозга от первичных реципиентов LDA (3 дожили до 16 недель): все вторичные реципиенты 10 6 клеток костного мозга из 100-клеточных и 50-клеточных первичных трансплантатов проявляли химеризм донорского PB на 12-й неделе жизни. недели (). Поскольку это были объединенные вторичные трансплантаты, мы можем только заключить, что по крайней мере 1 из 150 клеток на 28-й день были серийно трансплантируемыми долгосрочными HSC.Таким образом, мы оцениваем увеличение серийно приживляемых HSC как минимум в 54 раза (при условии, что все исходные клетки были функциональными HSC) и в 204 раза (при условии, что только 1:3,8 исходных клеток [~ 13 клеток] были функциональными HSC).

    В соответствии с высокой функциональной активностью на 28-й день маркеры старения не увеличивались, а Trp53 оставался без мутаций (,). Популяция KSL также оставалась отрицательной для связанной со старением бета-галактозидазы (, ) . Кроме того, приживление HSC было кариотипически нормальным (). Ex vivo фенотипические популяции KSL оставались довольно стабильными во время культивирования (, ), и большинство клеток в культурах оставались клон-отрицательными (на основе смеси клонов антител Ly-6G/Ly-6C/Ter119/CD45RA/CD4/CD8/CD127; ). Коктейль-положительные клетки линии были Ly-6G/Ly-6C + , хотя дополнительный анализ выявил клетки FceR1 + с аналогичными частотами (). Культуры HSC также можно было продолжать в течение более длительного времени: к 57-му дню культивирования 50 исходных HSC генерировали ~ 7.3×10 6 клеток при сохранении стабильной фенотипической популяции KSL и функциональной активности HSC (,; ).

    Хотя мышиные BM HSC могут быть высокообогащенными на основе экспрессии поверхностных маркеров, очищенные CD150 + CD34 клетки KSL демонстрируют значительную функциональную гетерогенность в анализах трансплантации отдельных клеток 24,25 . В соответствии с этим наблюдалась значительная изменчивость в размножении одиночных HSC, при этом некоторые клетки генерировали только <100 клеток, в то время как другие размножались до ~ 5×10 5 клеток (хотя >90% образовывали колонии; ).Наиболее пролиферативные клоны генерировали такое же количество клеток, как и культуры из 50 или 500 HSC (1), что указывает на ограниченный рост по площади поверхности. Фенотипическая гетерогенность также наблюдалась в культурах клонального происхождения; некоторые клоны сохраняли ~ 90% KSL (), в то время как другие почти исключительно генерировали клетки cKit + Sca1 Lin . Трансплантация клональных культур привела к высокому уровню мультипотентной активности у 4 из 14 реципиентов (1). Мы также обнаружили устойчивый (~ 15%) химеризм PB, когда культуры клонального происхождения были разделены и трансплантированы 5 реципиентам против 5 × 10 5 конкурентов BM (для 3 из 10 протестированных одиночных культур HSC; ,).Эти эксперименты подтвердили bona fide самообновление HSC ex vivo , но предположили, что способность к самообновлению неравномерно распределена внутри фенотипического компартмента HSC.

    Кондиционирование костного мозга на основе радиации обычно требуется, чтобы освободить место для донорских ГСК при трансплантации ГСК. Приживление донорского трансплантата у некондиционированных реципиентов возможно, но обычно невозможно, поскольку для трансплантации требуется очень большое количество ГСК 26,27 . Размножая 50 HSC за 28 дней до трансплантации, мы смогли добиться долгосрочного химеризма донорских PB и BM HSC у некондиционированных иммунокомпетентных мышей (-).Этот подход можно также использовать для прививки иммунодефицитных мышей NOD/SCID, модели врожденного иммунодефицита; мультилинейный химеризм ПВ наблюдался у всех реципиентов с донорскими лимфоидными В- и Т-клетками, обнаруженными в долгосрочной перспективе (-).

    Размноженные ex vivo HSC приживаются у некондиционированных реципиентов

    (a) Схема некондиционированной аутологичной трансплантации: 50 CD150 + CD34 Клетки KSL от мышей C57BL/6-CD45.1 были размножены в течение 28- дней до трансплантации в некондиционированные C57BL/6-CD45.1/CD45.2 реципиенты.

    (b) Средний 4–16-недельный химеризм донорских PB из 50 свежих HSC (n = 5) или 28-дневной культуры, полученной из 50 HSC (50 HSCeq; n = 5), трансплантированных, как описано в ( a ) .

    (c) Средний 16-недельный донорский BM CD34 KSL HSC химеризм (n = 5) для анализа, описанного в ( a ) ( слева ), и пример графика проточной цитометрии, отображающий CD45.1 и CD45 .2 экспрессия в компартменте BM CD34 KSL мышей-реципиентов ( справа ).

    (d) Графическая сводка оптимизированных условий для размножения функциональных мышиных HSC.

    Таким образом, мы разработали условия культивирования ex vivo без альбумина, которые расширяют функциональные мышиные HSC () с широким применением в исследованиях HSC. Хотя нам удавалось изолировать HSC высокой чистоты более 20 лет 1 , стабильное размножение ex vivo функциональных HSC оставалось неуловимым. Наши результаты показывают, что плохая оптимизация существующих компонентов культуры в сочетании с примесями добавок к средам была основным препятствием для расширения ex vivo HSC.

    Методы:

    Отчетность по данным.

    Статистические методы не использовались для предварительного определения размера выборки. Эксперименты не были рандомизированы, и исследователи не были слепы к оценке результатов.

    Мыши.

    Мыши C57BL/6-CD45.2 и C57BL/6-CD45.1 (PepboyJ) были приобретены у Japan SLC, Sankyo-Lab Service, Jackson Laboratories (000664, 002014) или выведены собственными силами. Для экспериментов по конгенной трансплантации в качестве доноров использовали мышей-самцов в возрасте 8–12 недель, а в качестве реципиентов — мышей-самок в возрасте 8–12 недель.Мыши с нокаутом TLR2, мыши с нокаутом по TLR4 и мыши NOD/Scid (NOD.Cg-Prkdc scid ) были приобретены у Jackson Laboratories (004650, 007227, 005557 и 001303 соответственно). Мышей NG (NOD.Cg-Prkdc scid Il-2rγ null /SzJ) приобретали у In Vivo Science Inc. Всех мышей содержали в условиях, свободных от конкретных патогенов (SPF), со свободным доступом к пище и воде. Все протоколы животных были одобрены Комитетом по уходу и использованию животных Института медицинских наук Токийского университета, Комитетом по уходу и использованию животных филиала RIKEN Tsukuba и/или Административной комиссией по уходу за лабораторными животными Стэнфордского университета.

    Сбор клеток методом флуоресцентной сортировки клеток (FACS).

    Клетки костного мозга мыши выделяли из большеберцовой кости, бедренной кости и таза, окрашивали антителами APC-cKit и cKit-позитивными клетками, обогащенными с использованием магнитных шариков против APC и колонок LS (Miltenyi Biotec). Обогащенные cKit клетки окрашивали коктейлем клональных антител (биотинилированные-CD4, -CD8, -CD45RA/B220, -TER119, -Gr1 и -CD127) перед окрашиванием анти-CD34, анти-cKit, анти- Sca1 и стрептавидин-APC/eFluor 780 (как подробно описано в ) в течение 90 минут.Там, где указано, клетки также окрашивали анти-CD150. Затем клеточные популяции очищали с использованием FACS AriaII (BD) путем прямой сортировки в лунки, содержащие среды, с использованием PI в качестве красителя живой/мертвый ().

    Культуры клеток мышей на основе сывороточного альбумина.

    Посев на основе сывороточного альбумина проводили с использованием среды F12 (Life Technologies), 1% инсулин-трансферрин-селен-этаноламин (ITSX; Life Technologies), 1% пенициллин/стрептомицин/глутамин (P/S/G; Life Technologies) , 10 мМ HEPES (Life Technologies), 0.1% рекомбинантный сывороточный альбумин человека (HSA; Albumin Biosciences), при 37°C с 5% CO 2 . Культуры были дополнены рекомбинантным мышиным SCF и рекомбинантным мышиным TPO (Peprotech), как указано. Во всех долговременных культурах использовали 10 нг/мл SCF и 100 нг/мл TPO, при этом замену среды производили каждые 3 дня после первых 5 дней путем ручного удаления кондиционированной среды путем пипетирования и замены свежей среды, как указано. В лунках 96-луночного планшета, содержащих 200 мкл среды, это включало осторожное удаление 190–200 мкл кондиционированной среды с помощью пипетки, чтобы не повредить клетки, слегка прилипшие ко дну лунки, а затем осторожное пипетирование 200 мкл предварительно обработанной среды. – подогретую и свежеприготовленную среду вниз по стенке лунки, чтобы свести к минимуму нарушение клеточного слоя.Любые клетки, удаленные из лунки в кондиционированной среде, отбрасывали. Длительное культивирование проводили с использованием планшетов с плоским дном, обработанных тканевой культурой и/или покрытых фибронектином (Corning; 354409), коллагеном 1 (Corning; 354407), коллагеном 4 (Corning; 354429), желатином (Sigma; G2500) или Ламинин511 (iMatrix; 892018). Где указано, к культурам добавляли различные концентрации рекомбинантного мышиного IL-6 (Peprotech).

    Культуры клеток мыши, не содержащие сывороточный альбумин.

    HSC культивировали в среде, состоящей из среды F12, 1% ITSX, 1%, 10 мМ HEPES, 1% P/S/G, 100 нг/мл мышиного TPO, 10 нг/мл мышиного SCF и 0.1% одного из следующих химических веществ (все от Sigma): гидроксипропилцеллюлоза (HPC; 435007), натриевая соль карбоксиметилцеллюлозы низкой вязкости (CMC-LV; C5678), натриевая соль карбоксиметилцеллюлозы средней вязкости (CMC-MV; 21902), альфа- циклодекстрин (альфа-CD; C4642), бета-циклодекстрин (бета-CD; C4767), гамма-циклодекстрин (гамма-CD; C4930), 2-гидроксипропил-бетал-циклодекстрин (HBC; h207), 2-гидроксипропил-гамма- циклдекстрин (HGC; h225), метил-бета-циклодекстрин (MBC; C4555), полоксамер 188 (polox188; P5556) или поливиниловый спирт (PVA; P8136, 363081 или 363146) при 37°C с 5% CO 2 .Для долговременных культур в культурах на основе ПВС полная замена среды производилась каждые 2–3 дня после первых 5–6 дней, как описано выше для культур на основе альбумина. Долгосрочные культуры разделяли 1:3 при слиянии ~90%. Где указано, к культурам добавляли липополисахарид (LPS; Sigma L2762) или IL-6 (Peprotech).

    Анализ культивируемых клеток.

    После культивирования ex vivo клетки подсчитывали (с использованием гемоцитометра, цитометра CYTORECON или Nucleocounter NC-3000).Для проточного цитометрического анализа клетки окрашивали коктейлем клонов (биотинилированные CD4, -CD8, -CD45RA/B220, -TER119, -Gr-1 и -CD127), а затем детализировали антителами в течение 30–90 минут. После этапа промывки был проведен проточный цитометрический анализ с использованием FACS AriaII (BD), LSRFortessa (BD) или FACS Canto (BD) с использованием PI в качестве живого/мертвого красителя.

    Анализ конкурентной трансплантации.

    Культуральные HSC от мышей C57BL/6-CD45.1 трансплантировали вместе с 1×10 6 целых клеток-конкурентов BM C57BL/6-CD45.1/CD45.1 (F1) мышей в C57BL/6-CD45.2 после облучения летальной дозой (9,5 Гр). Донорский химеризм отслеживали путем сбора клеток периферической крови (PB) и окрашивания анти-CD45.1, анти-CD45.2, анти-CD11b, анти-Ly-6G/Ly-6C, анти-CD45RA (B220), анти- CD4, анти-CD8 антитела (подробно) в течение 30 минут. После этапа промывки клетки анализировали с помощью проточной цитометрии (как указано выше), используя PI в качестве красителя живой/мертвый. Анализ вторичной трансплантации костного мозга проводили путем переноса 1×10 6 клеток костного мозга от первичных мышей-реципиентов в летально облученные клетки C57BL/6-CD45.2 мыши с донорским химеризмом анализировали, как указано выше.

    Анализы с предельным разведением.

    Для анализа предельных разведений установленное количество культивируемых клеток C57BL/6-CD45.1 разделяли на аликвоты с помощью FACS после культивирования и трансплантировали летально облученным мышам-реципиентам C57BL/6-CD45.2 вместе с 2×10 5 F1 BM клетки-конкуренты. Донорный химеризм анализировали, как описано выше. Анализ предельных разведений выполняли с использованием программного обеспечения ELDA 23 на основе химеризма мультилинии 1% PB (не менее 0.2% миелоидного донорского химеризма) как порог положительного приживления. Для расчета частоты свежих HSC те же критерии были применены в общей сложности к 138 анализам трансплантации из свежеизолированных CD150 + CD34 клеток KSL, которые мы опубликовали ранее 24,25 . Там, где это указано, анализы вторичной трансплантации проводили, как описано выше.

    Некондиционированные анализы трансплантации.

    CD150 + CD34 Клетки KSL очищали от C57BL/6-CD45.1 или мышей C57BL/6-CD45.2 и размножались, как описано выше. Свежевыделенные или размноженные клеточные культуры затем трансплантировали необлученным мышам-реципиентам C57BL/6-CD45.1/CD45.2 или мышам-реципиентам NOD/SCID (CD45.1), разделенным на три дозы в течение последовательных дней.

    Иммуноанализ цитокинов.

    Кондиционированные среды собирали на 7-й день (до любой замены среды) или на 14-й день (после смены среды на 10-й день), или как указано в подписях к рисункам. Наборы мыши 39-plex (eBiosciences) использовали в соответствии с рекомендациями производителя с модификациями, описанными ниже.Вкратце, шарики добавляли в 96-луночный планшет и промывали в промывочной машине Biotek ELx405. Образцы добавляли в планшет, содержащий смешанные шарики, связанные с антителами, и инкубировали при комнатной температуре в течение одного часа с последующей инкубацией в течение ночи при 4°C при встряхивании. Стадии инкубации при холодной и комнатной температуре проводили на орбитальном шейкере при 500–600 об/мин. После инкубации в течение ночи планшеты промывали в промывочной машине Biotek ELx405, а затем добавляли биотинилированные антитела для детекции на 60 минут при комнатной температуре при встряхивании.Планшет промывали, как указано выше, и добавляли стрептавидин-РЕ. После инкубации в течение 30 минут при комнатной температуре проводили промывку и добавляли в лунки буфер для считывания. Планшеты считывали с использованием прибора Luminex Flex3D с нижней границей 50 гранул на образец на цитокин. Индивидуальные контрольные шарики (анализ CHEX) от Radix Biosolutions добавляли во все лунки.

    Культуры клеток человека и анализы ксенотрансплантатов.

    Клетки CD34 + , полученные из пуповинной крови человека (приобретенные у Lonza или Stem Cell Technologies), или очищенные с помощью FACS CD34 + CD38 CD90 + CD49f + 40030 CD49f + 40030 окрашивание клеток [Biolegend; 560940], PE-CD38 [BD; 347687], FITC-CD90 [Biolegend; 328113] и APC/Cy7-CD49f [Biolegend; 313611]) культивировали в среде IMDM (Life Technologies), содержащей 0.1% HSA или 0,1% PVA (Sigma P8136, 363081 или 363146) с добавлением 1% ITSX, 1% P/S/G, 10 мМ HEPES. Для анализа пролиферации 50 клеток высевали на лунку и добавляли 10 нг/мл человеческого SCF и 100 нг/мл человеческого TPO (Peprotech). Во время культивирования среду обновляли каждые три дня и подсчитывали на 7-й день. Для анализа ксенотрансплантата 2×10 3 клеток размножали в течение 7 дней перед внутривенной инъекцией сублетально облученным (1,5 Гр) мышам NOG. Химеризм клеток человека в PB рассчитывали через 16 недель после трансплантации с использованием PE/Cy7-CD45.1 (Biolegend; 110730) и антитела V450-hCD45 (BD; 560367).

    Анализ старения.

    Тотальную РНК клеток KSL экстрагировали с использованием набора RNeasy Mini Kit (QIAGEN) и подвергали обратной транскрипции с использованием системы синтеза первой нити SuperScript III и праймеров Oligo (dT) (Invitrogen). КПЦР проводил на термоциклеру Dice системы реального времени (Takara) с помощью SsoAdvancedTM Универсального SYBR Green Supermix и следующие наборы праймеров: p16INK4A (GAACTCTTTCGGTCGTACCC и CGAATCTGCACCGTAGTTGA), p19Arf (GGGTTTTCTTGGTGAAGTTCG и TTGCCCATCATCATCACCT), и Trp53 (CAGTCTACTTCCCGCCATAA и GTCTCAGCCCTGAAGTCATAAG).Условия реакции: 95°С в течение 10 мин, затем 40 циклов: 95°С в течение 15 сек, 60°С в течение 30 сек и 72°С в течение 20 сек. Экспрессию генов нормализовали относительно экспрессии Gapdh (с использованием набора праймеров: CGACTTCAACAGCAACTCCCACTCTTCC и TGGGTGGTCCAGGGTTTCTTACTCCTT). Окрашивание Senescence бета-галактозидазой (Cell Signaling, набор 9860S) проводили в соответствии с инструкциями производителя после прикрепления клеток к планшетам, покрытым поли-L-лизином. Для секвенирования по Сэнгеру кДНК Trp53 амплифицировали с помощью ПЦР (с использованием набора праймеров: CATCCTGGCTGTAGGTAGCG ACCCTATGAGGGCCCAAGAT) и секвенировали с использованием вложенных праймеров для секвенирования: AAAAGTCTGCCTGTCTTCCAG; TGATGGCCTGGCTCCTCC; CACGTACTCTCCTCCCCTCA; и CTTCTGTACGGCGGTCTCTC.Секвенирование по Сэнгеру было передано на аутсорсинг компании FASMAC Co. Ltd, а визуализация и выравнивание выполнялись с помощью программного обеспечения SnapGene.

    Флуоресцентное иммуноокрашивание фосфопротеинов.

    Флуоресцентное иммунное окрашивание выполняли путем прикрепления, фиксации и окрашивания клеток на предметных стеклах, покрытых поли-1-лизином (Matsunami Glass, Осака, Япония), с визуализацией и количественным определением, выполненным с помощью считывающего устройства Cellomics ArrayScan VTI HCS (ThermoScientific), с использованием методы, описанные ранее 20,28 .

    Кариотипический анализ.

    Кариотипирование проводили на клетках ВМ CD45.1 + , очищенных с помощью FACS от первичных реципиентов 28-дневных ПВА-культивируемых HSC через 16 недель после трансплантации, и проводили Nihon Gene Research Laboratories Inc. (Япония).

    Статистический анализ.

    Односторонний и двусторонний тесты ANOVA и непарные двусторонние t-критерии были выполнены, как показано на рисунках, с использованием программного обеспечения Prism 7.

    Борьба с грызунами Брисбен | Уничтожитель крыс и мышей

    Грызуны — одни из самых надоедливых вредителей, которые могут быть в вашей собственности.Помимо разрушения, которое они могут принести — кража продуктов на кухне, порча вашей одежды и мебели — они также представляют угрозу для здоровья, поскольку известны как переносчики болезней.

    Ваш дом или бизнес следует всегда проверять на наличие грызунов или риск проникновения, если вы хотите избежать заражения. В Termex Pest Management работает команда лицензированных технических специалистов, обладающих знаниями в области проверки и лечения нашествий грызунов.

    Предотвращение проникновения грызунов

    Основная причина, по которой грызуны так любят прятаться в вашем доме, — это запасы еды.Пока у них есть еда и вода, а доступ в ваш дом не затруднен, ожидайте, что грызуны будут регулярно навещать вас. Хуже того, они могут даже построить свое гнездо в пустотах крыши и других скрытых местах в вашей собственности.

    Первый шаг, который нужно сделать, если вы не хотите приглашать грызунов, — это убедиться, что вы ограничиваете доступный им источник пищи и воды. Храните продукты питания в закрытых контейнерах, которые нельзя жевать. Проверьте сантехнику на наличие утечек и при необходимости произведите ремонт.Держите мусорное ведро плотно закрытым и выносите мусор каждую ночь, чтобы не привлекать грызунов и других вредителей.

    Отверстия в стенах и вокруг электрических розеток и труб должны быть закрыты, чтобы крысы и мыши не могли использовать их в качестве прохода или укрытия. Трещины и щели можно залить цементом или закрыть металлическими пластинами.

    Использование ловушек

    Ловушки можно использовать на участках, где химические пестициды недопустимы. Разнообразные ловушки включают простую ловушку с защелкой, устройство для ловли нескольких мышей и клеевые доски.Большинство ловушек предназначены для использования приманки для заманивания грызунов.

    Химическая обработка

    Если в вашем доме или офисе сильное нашествие грызунов, Termex Pest Management может помочь вам внедрить эффективный метод химической борьбы. Некоторые из химических средств, которые мы используем, включают следящие порошки и гели, фумигацию и приманку. Использование этих пестицидов может быть опасным для жильцов при неправильном применении, поэтому необходимо, чтобы этим процессом занимался обученный техник.

    Хотя вы можете заметить крыс или мышей, бегающих по вашей собственности, степень заражения часто трудно определить. Если вы хотите проверить свой дом на наличие грызунов или вам нужна помощь в борьбе с вредителями, вы можете позвонить в нашу команду, и мы избавимся от них.

    Борьба с вредителями Брисбен

    Наша гарантия действует, если вредители возвращаются, то и мы тоже.


    Все они относятся к семейству насекомых. Они могут не досаждать вам снаружи, но муравьи, осы и пчелы, гнездящиеся в вашем доме, могут быстро стать проблемой.Наши лицензированные специалисты – быстрое решение вашей проблемы с вредителями. Если вы хотите предотвратить эти проблемы в вашем доме или на работе, пожалуйста, свяжитесь с нами сейчас.


    Ковер может быть идеальной средой для некоторых насекомых, в том числе ковровых жуков и платяной моли. Им нравится поедать ткани, сделанные из животных волокон, но известно, что они нападают на синтетические волокна, загрязненные пищей или экскрементами животных. Профилактика является обязательной, когда речь идет о коврах, потому что, как только ворс начинает уходить, ущерб уже нанесен.Поговорите с нашим лицензированным техническим специалистом Termex, и мы будем рады спланировать с вами решение для ваших конкретных потребностей.


    Американские, австралийские и немецкие тараканы, к сожалению, обитают во многих домах, офисах и ресторанах. Они, как правило, являются наиболее распространенными и нелюбимыми вредителями. У тараканов большой аппетит практически ко всему — овощам, сыру, пиву, коже, крахмалу (особенно в переплете книг), клею, волосам и любым пищевым продуктам (особенно сладостям). Тараканы не любят по очень веской причине, то есть они обладают способностью переносить болезнетворные организмы, к которым относятся сальмонеллез, дизентерия, диарея и многие другие.Эти заболевания переносятся на ногах и теле тараканов. Все, к чему прикасается таракан, заражено этими микробами. Хорошей новостью является то, что средство для борьбы с вредителями Termex может очистить ваш офис или дом от тараканов.


    Блохи любят жить на кошках и собаках, однако обычно они размножаются от домашних животных, то есть любят размножаться в ковре. Большинство людей не замечают блох в своем ковре, вероятно, потому, что блохи могут оставаться в коконах в течение нескольких месяцев. Если вы хотите предотвратить эти проблемы в вашем доме или на работе, пожалуйста, свяжитесь с нами сейчас.


    Грызуны могут нанести серьезный ущерб домам и предприятиям. Хранящиеся продукты могут заразиться, потому что грызуны поедают пищу или загрязняют ее своей мочой, фекалиями и волосами. Грызуны играют большую роль в передаче смертельных болезней (бубонный налет, пищевое отравление сальмонеллезом, мышиный сыпной тиф, болезнь Вейля, трихинеллез и ряд других заболеваний). Также грызуны могут разрушать жилища, прогрызая все, начиная от зданий, мебели, книг, оборудования и техники.Не отчаивайтесь, так как у вашего специалиста по борьбе с вредителями Termex есть решение вашей проблемы с грызунами.


    Пауки — не самые популярные обитатели дома. Фактически, они являются одними из самых страшных и нелюбимых существ в Австралии. Пауки, которых можно найти в жилых районах, включают черного домашнего паука, коричневого домашнего паука, коричневую вдову, паука-люка с щеткой, паука-шароплета, паука-охотника, паука-мыши, красноспинного паука, креста Сент-Эндрюса, белохвостого паука. паук и паук-волк.Если вы не хотите делить свой дом с этими пауками — свяжитесь с нами прямо сейчас.


    Книжные клещи, мучные клещи, чешуйницы и рисовые долгоносики — это лишь некоторые из существ, которые предпочитают жить в вашей теплой спокойной среде. Это включает в себя ваши стены, шкафы, контейнеры для пищевых продуктов, электрические розетки, мебель, коробки, книги и бумагу. Если вы хотите предотвратить эти проблемы в вашем доме или на работе, пожалуйста, свяжитесь с нами сейчас.


    Клеевые продукты Catchmaster теперь доступны

    Ассортимент клея Catchmaster теперь можно приобрести во всех филиалах Garrards.

    Семейство продуктов Catchmaster Professional Присоединяйтесь к Garrards Stable

    Atlantic Paste & Glue Company, семейный бизнес, подобный Garrards, уже более века производит качественные специальные клеевые продукты. В 1977 году AP&G представила линейку продуктов Catchmaster и сосредоточилась на разработке клеев для борьбы с вредителями. С тех пор AP&G стала лидером отрасли и постоянно производит новые и инновационные высококачественные продукты для борьбы с вредителями.

    Компания Garrards рада объявить о своем назначении в качестве дистрибьютора этого разнообразного ассортимента в Австралии. У компании Catchmaster есть клей, который удовлетворит любые ваши потребности: доски для мышей и крыс, ловушки и мониторы для насекомых, доски для гигантских крыс и ловушки для мух.

    Клей, используемый в продуктах Catchmaster, не содержит масла, как в некоторых других продуктах. Масло смешивается с химическим составом тела грызуна и позволяет грызуну сбежать. Масло также может способствовать просачиванию клея и, следовательно, работе в жарких условиях.

    Для ознакомления с ассортиментом ниже вы можете найти изображения различных продуктов, а также некоторые указания на их основные области применения. Мы также включили наш код продукта для вашего удобства заказа, однако при заказе не обязательно указывать наши номера деталей, и мы не требуем, чтобы вы заказывали партиями в картонных коробках. Обратите внимание, что использование этих продуктов не ограничивается рекомендациями, изложенными ниже.



    Лотки с клеем для крыс – CM48RB
    В результате 10 лет исследований и разработок эти ловушки были испытаны в полевых условиях (а не в лаборатории) и каждый раз оказывались победителями.Подносы на черной основе доступны уже сейчас. Подносы для крыс упакованы в картонные коробки по 24 упаковки по 2 шт. “Hercules Putty” (см. ниже) также доступен для крепления ловушек к полу и т. д. без использования гвоздей Ramset, болтов Dyna или других подобных крепежных изделий. Размер ловушки = 26,03 см x 13,335 см

     

     

     



    Замазка Hercules — CMHP-115
    Настоятельно рекомендуется для удержания ловушек клея на месте. Может помешать 2-килограммовой крысе сбежать с вашего лотка.Мониторы насекомых также можно монтировать в вертикальном положении на стенах или в перевернутом виде под шкафами и столешницами. Доступен в рулонах длиной 15 футов (прибл. 4,57 м).



    Клеевые доски Econo для крыс – CM60RBGL
    Простое решение для мест с ограниченным доступом или там, где необходимо изготовить ловушки по размеру. Ловушки легко обрезаются для нанесения по контуру – просто держите быстросъемную бумагу на месте и, используя мыльные или смазанные маслом ножницы, обрежьте ловушки по размеру. С ароматом арахисового масла.Можно вставить в пылезащитный чехол для древесных зерен (см. ниже), а также можно оторвать боковую сторону сифона для использования у стен. Упаковано в картонные коробки по 60 досок – Размер ловушки = 30,798 см x 15,24 см

     



    Пылезащитный чехол для 48RB – CM150RB
    Пылезащитный чехол “Rodent Barn” повышает эффективность и продлевает срок службы изделий из клея для ловли грызунов за счет поддержания низкой запыленности среды. Внешний вид под дерево также служит для защиты грызунов от посторонних глаз.Используется в таких местах, как загоны для животных, склады, пекарни и т. д. Упаковано в картонные коробки по 150 крышек. Размер = 46,99 см x 25,4 см

     

     



    Доски для клея Giant Rat — CM24GRB
    Беспрецедентное клеящее покрытие с более чем 800 кв. см и 250 г силы захвата клея. Используйте плоскую поверхность для очистки или складывайте для использования в пыльных местах. Перфорированная сторона отрывается для размещения у стен, чтобы закрепить ловушки и не дать грызунам утащить ловушку.Используйте под поддонами или механизмами на складах или в коммерческих помещениях. Предварительно наживка с запахом арахисового масла. Упаковано в картонные коробки по 24 платы. Размер ловушки = 46,99 см x 26,67 см.

     

     

     



    Клеевые платы Super Mouse — CM72MBPB и CM72MBCH
    Клеевые платы серии 72MB — это просто лучшие клеевые платы для мыши на современном рынке. Улавливающая поверхность составляет 206 кв. см. Ловушку можно использовать как в плоском, так и в сложенном виде. Он имеет перфорированную отрывную полосу для крепления платы к плинтусам и т. д., а на обратной стороне доски имеется печатный регистратор. Доступен как с ароматом арахисового масла, так и с ароматом шоколада. Упаковано в картонные коробки по 72 платы. Размер ловушки = 21,59 см x 13,335 см

     

     

     



    Доски Econo для приклеивания мышей и насекомых – CM150MBGL
    Эти доски меньше, чем ловушки 72MB, и поэтому идеально подходят для ситуаций, когда мишенью вредителей являются мыши. Перфорированные, чтобы их можно было сложить или разорвать для размещения рядом со стенами, и они складываются, образуя туннель.Аромат арахисового масла. Упаковано в картонные коробки по 150 досок. Размер ловушки = 17,18 см x 8,89 см

     

     



    Ловушка для насекомых и монитор — CM288I
    Складывается в прямоугольник или треугольник, как показано на фото. Боковое окно позволяет легко проводить осмотр, а также обеспечивает альтернативный доступ для насекомых. Очень привлекательный состав патоки/арахисового масла раздражает тараканов. На обратной стороне напечатан календарь недели/месяца. Упаковано в картонные коробки по 72 ловушки (1 ловушка = 3 монитора, как показано) – Размер ловушки (лист) = 25.08 см x 19,05 см (один монитор = 25,08 см x 6,35 см в развернутом виде)

     

     

     

     



    Ароматизированная ловушка для насекомых и мух – CM9144M4
    Для использования в домашних условиях, в коммерческих и сельскохозяйственных целях. Может использоваться для борьбы с надоедливыми мухами, а также для мониторинга популяций мух в рамках применения средств борьбы с ИЗР для определения времени опрыскивания. Это также элемент, который может быть включен в лечение или продаваться, чтобы помочь предотвратить повторные звонки.Упаковано по 4 шт., по 24 упаковки по 4 шт. в коробке.

     

     

     

     



    Гигантская клеевая ловушка для мух — CM902
    Размеры этой ловушки 30,48 см x 60,96 см, площадь поверхности для ловли мух составляет 1,858 кв. м. Каждая ловушка содержит запатентованный пищевой аттрактант, феромоновый аттрактант и специальный флуоресцентный зеленовато-желтый цвет. Для использования в коммерческих или ветеринарных учреждениях, где необходима борьба с мухами без использования химикатов для предотвращения загрязнения пищевых продуктов или где мухи доставляют неудобства.Упакованы по 2 упаковки, 24 упаковки по 2 шт. в коробке.

     

     



    Клеевые ловушки для конных мух – CM935
    Эта двусторонняя ловушка для мух площадью более 38 000 кв. см была разработана для решения самых сложных ситуаций с мухами. Аттрактанты включают феромоны, пищевые аттрактанты и особый флуоресцентный зеленовато-желтый цвет. Вытяните по частям и повесьте в местах с высокой популяцией мух. Одна ловушка может поймать более 100 000 мух. Университетские испытания показали, что при использовании клеевой ловушки Equestrian Fly Glue Trap из расчета одна ловушка на 55 кв.метров, в районах с высокой зараженностью удалось достичь 70-80% контроля без использования каких-либо химикатов. Идеально подходит для использования в сараях, стойлах, птичниках, местах хранения мусора или в любых других ситуациях, где мухи присутствуют в большом количестве. Упаковано в картонные коробки по 12 рулонов Размер ловушки = 7 м x 27,94 см

     

     

     

     



    Деревянная ловушка с защелкой размером с мышь — CM602
    Что сказать? Старая надежная деревянная ловушка, которой Бабушка и дедушка клялись в ней.Эти сверхмощные ловушки изготовлены из высококачественных материалов и имеют сверхчувствительные спусковые крючки для обеспечения поимки. По цене они могут быть добавлены к стоимости работы по борьбе с грызунами и оставлены клиентам, они являются еще одним недорогим способом уменьшить вероятность обратного вызова по этим проблемным работам. Упакованы в двойные упаковки.



    Деревянная ловушка размером с крысу — CM610
    Что сказать? Старая надежная деревянная ловушка, которой Бабушка и дедушка клялись в ней. Эти сверхмощные ловушки изготовлены из высококачественных материалов и имеют сверхчувствительные спусковые крючки для обеспечения поимки.По цене они могут быть добавлены к стоимости работы по борьбе с грызунами и оставлены клиентам, они являются еще одним недорогим способом уменьшить вероятность обратного вызова по этим проблемным работам. Упакованы в двойные упаковки.



    Humane Concerns

    Любое животное, попавшее в любую из этих ловушек, можно освободить от клея Catchmaster следующим образом. Используя плотные промышленные резиновые перчатки, нанесите растительное или минеральное масло на поверхность ловушки (там, где застряло животное) и держите ловушку вверх дном над ведром.С помощью тупого предмета, т. е. обратной стороны карандаша, слегка надавите на животное и отпустите его в ведро. Сделайте шаг назад, затем наклоните ведро от себя, когда отпускаете животное. Выпуск реодентов должен производиться на расстоянии не менее 2 км от места их отлова во избежание повторного заражения.

    Эти инструкции напечатаны на каждой упаковке, чтобы сделать эту информацию доступной для всех покупателей и пользователей (профессиональных или конечных пользователей)

    Преимуществом клеевых ловушек является тот факт, что любой эктопаразит, присутствующий на животном, не может сбежать, в отличие от родентицидов или ловушек с защелкой что позволит болезнетворным организмам, таким как блохи, покинуть своих хозяев.

    Рекомендуется использовать сквозной мониторинг для предотвращения прилипания грызунов к лоткам на длительное время.


    Как всегда, доступна дополнительная информация, такая как каталоги продукции, поэтому, пожалуйста, не стесняйтесь обращаться к любому из наших дружелюбных сотрудников, чтобы договориться о его отправке вам.

    Catchmaster имеет информативный веб-сайт, где вы можете найти дополнительную информацию. Вы можете получить доступ к этому сайту, нажав на эту ссылку.

    Что такое сетчатая система термитов? – Рестораннорман.ком

    Что такое сетчатая система термитов?

    Система ретикуляции термитов представляет собой серию подземных трубопроводов, расположенных вокруг дома. Его цель – обеспечить постоянную защиту от термитов. Преимущество, конечно, в том, что его можно неоднократно пополнять термитицидом – с помощью специального оборудования и насосов.

    Как вы используете Термекс?

    Просверлите отверстия диаметром 12 мм с интервалом 30 см на стыке пола и стены на глубину 30 см.Впрыскивайте раствор TERMEX 350 SC (0,075% а.и.) в эти отверстия с помощью ручного нагнетательного насоса до отказа или максимум 1 л на отверстие. После обработки отверстия герметизируются.

    Как долго сохраняется сетчатая структура термитов?

    Домашняя страница / Системы ретикуляции Химические вещества, используемые сегодня, могут храниться до 5-7 лет, они применяются в соответствии с австралийскими стандартами и являются лучшими из доступных. Химические вещества предназначены для отпугивания термитов от вашей собственности, что делает ваш дом безопасным от нападения термитов.

    Как вы делаете ретикуляционную систему?

    шагов

    1. 1Выкопайте траншею по периметру.
    2. 2Отрежьте трубы из ПВХ по длине.
    3. 3Вставьте тройники в места расположения спринклеров.
    4. 4Установите электромагнитный клапан на источнике воды.
    5. 5Загрунтуйте и склейте соединения.
    6. 6Прикрепите разбрызгиватели.
    7. 7Засыпать траншею.
    8. 8Проверьте, правильно ли работает система.

    Какой химикат для борьбы с термитами является лучшим в Индии?

    5 лучших убийц термитов

    • Taurus SC: Самый популярный.
    • Bifen XTS: Лучшее быстродействующее средство.
    • Spectracide Terminate: лучшая приманка.
    • Пена Termidor: лучшая прямая химическая обработка.
    • Убийца термитов BioAdvanced: лучше всего подходит для самостоятельного изготовления.

    Сколько стоит заполнить барьер от термитов?

    Reticulation Reticulation Refill – от 290 долларов США – проверенная защита от вредителей.

    Стоит ли покупать термитную гарантию?

    Однако гарантия от термитов стоит затрат на защиту вашего дома. Средняя стоимость ремонта термита составляет около 3000 долларов.Ремонт некоторых термитов может стоить десятки или даже сотни тысяч долларов, поэтому гарантия того стоит.

    Как работает ретикуляция?

    Система ретикуляции воды помогает воде двигаться от первоисточника к потребителю. Еще одним фактором при планировании и проектировании системы является учет требуемого объема воды. Вода движется с помощью энергии и должна преодолевать любое сопротивление, с которым она сталкивается при изменении высоты.

    Что такое система газораспределения?

    Сетчатая система представляет собой средство подачи сжиженного нефтяного газа или «варочного газа» в виде пара.Это достигается прохождением его по выделенной сети трубопроводов, начиная от пункта централизованного хранения газа (наливного резервуара) в жилом комплексе до каждой кухни. Подача измеряется точно так же, как это делается для воды и электричества.

    Как избавиться от термитов без палатки?

    Микроволновка. Микроволновая печь является эффективным методом для локализованных заражений термитами из сухой древесины. Этот быстрый метод направляет микроволны на зараженную область, проникая в древесину, содержащую термитов.Микроволны превращаются в тепло, почти мгновенно убивая термитов.

    Top Termite Control рядом со мной в Эрнакуламе – Best Termite Control рядом со мной в Ernakulam – Страница 1

    Премиум

    • Нам доверяют пользователи
    • Подлинный список
    Сегодня (с 08:00 до 21:30 Все закрыто)
    • ПН 08:00 До 21:30
    • Вт 08:00 До 21:30
    • Ср 08:00 До 21:30
    • Чт 90 08:09: 0 До
    • ПТ с 08:00 до 21:30
    • СБ с 08:00 до 21:30
    • ВС Праздничные дни

    За время своего существования это предприятие прочно закрепилось в своей отрасли.Вера в то, что удовлетворенность клиентов так же важна, как и их продукты и услуги, помогла этому заведению собрать обширную клиентскую базу, которая продолжает расти с каждым днем. В этом бизнесе работают люди, которые преданы своим обязанностям и прилагают много усилий для достижения общего видения и более крупных целей компании. В ближайшем будущем этот бизнес планирует расширить свою линейку продуктов и услуг и обслуживать более широкую клиентскую базу. 20:00 ) Закрыто в любое время

    • ПН 08:00 До 20:00
    • Вт 08:00 До 20:00
    • Среда 08:00 До 20:00 ЧТ
    • 90 90 00:00 До 20:00
    • ПТ 08:00 До 20:00
    • СБ 08:00 До 20:00
    • ВС 08:00 До 20:00
    • 1.95 95Лечение от термитов: • Термиты полезны для окружающей среды, потому что они расщепляют мертвые деревья и другие растительные материалы на вещества, полезные для растений, но они, безусловно, не приносят пользы домам. Многие виды термитов наносят значительный ущерб домам, офисам, нашей мебели, деревянным заборам и другим конструкциям. … • Подземные термиты гнездятся в земле и зарываются в древесину, обычно в поваленные деревья и пни. Они проникают в древесину зданий там, где она соприкасается с землей, или по туннелям через трещины в фундаменте.• Отдельный сегмент услуг по борьбе с вредителями направлен на борьбу с термитами в зданиях, древесине, мебели и приспособлениях. Это делается в качестве предстроительной профилактической меры, послестроительной лечебной обработки и для поврежденных деревянных конструкций и т. д. Подробнее


      Премиум

      • Нам доверяют пользователи
      • Подлинный список

      Термиты являются особенно опасными вредителями, поскольку они могут нанести серьезный ущерб вашему дому или рабочему месту.Самодельные средства от термитов, такие как спрей от термитов, могут быть не в состоянии справиться с заражением термитами на корневом уровне, особенно в случае больших колоний термитов. Получение средств от термитов у эксперта по борьбе с вредителями — это лучший способ удалить термитов с вашей собственности и защитить ваши драгоценные вещи. Летающие термиты в доме или выходящие из фундамента стены указывают на заражение термитами, которое требует немедленного лечения. Другими признаками заражения являются грязевые трубки на стенах, дупла в деревянных изделиях, поврежденная древесина/деревянная мебель и выброшенные крылья термитов.мы также рекомендуем регулярно следить за вашей собственностью и окрестностями, чтобы держать их в неблагоприятных условиях для заражения термитами. S + More


      Premium

    • Доверяется пользователям
    • Доверяется пользователем
    • Надуксина Список
    Сегодня (Открыть 24 часа) Открыть сейчас Все часы
    • PON Открыть 24 часа
    • Tue Открыть 24 часа
    • Ср. Открыто 24 часа
    • ЧТ Открыто круглосуточно
    • ПТ Открыто круглосуточно
    • Суббота Открыто круглосуточно
    • ВС Открыто круглосуточно

    Когда у вас есть проблема с вредителями, особенно когда проблем несколько, вам нужно наиболее эффективное решение для борьбы с вредителями.Компания Fumitech разработала стандартные операционные процедуры (СОП) для каждого жилого и коммерческого объекта. Вредители в доме могут нанести ущерб имуществу и вызвать проблемы со здоровьем в вашей семье. Мы можем устранить любую проблему с вредителями, которая может у вас возникнуть, а также посоветовать, что вы можете делать по дому, чтобы предотвратить заражение в будущем. безопасность вашей семьи и домашних животных. Работаете ли вы в сфере здравоохранения, гостиничного бизнеса, фармацевтики, пищевой промышленности и упаковки, путешествий, хранения и складирования; среда, свободная от вредителей, является абсолютной необходимостью.Мало того, что мы на переднем крае в Integrat + More


    Premium

    • Доверяются пользователям
    • Надукшими листинг
    Сегодня (открыто 24 часа) Открыть сейчас все часы
    • PON Открыть 24 часа
    • Tue Открыть 24 часа
    • Ср Открыто круглосуточно
    • ЧТ Открыто круглосуточно
    • ПТ Открыто круглосуточно
    • Суббота Открыто круглосуточно
    • Вс Открыто круглосуточно

    Pestban Pest Control Services — это одно из инновационных решений коммерческих поставщиков услуг по борьбе с вредителями.Pestban Pest Control Services обеспечивает более высокий уровень профессионализма в отрасли борьбы с вредителями благодаря своей опытной в отрасли сервисной группе. Компания вышла на рынок, чтобы предоставлять необходимые услуги по упреждающему уничтожению вредителей, санитарию окружающей среды и техническое обслуживание жилых, коммерческих, промышленных клиенты. Pestban Pest Control Services — это растущая компания, в которой работают опытные специалисты по борьбе с вредителями. Мы надеемся способствовать лучшему пониманию коммерческой структурной и пищевой безопасности; экологическая санитария, техническое обслуживание и ведение хозяйства; и здоровье и благополучие всех в коммерческих городских и пригородных нарядах.Это обязательство дойдет до местных сообществ через + More


    PCS HI-CARE Kacheripady, Ernakulam Посмотреть местоположение Посмотреть номера телефонов

    Premium

    • Доверенные пользователи
    • Подлинный список
    • : :00 PM ) Закрыто круглосуточно

      • ПН 09:00 До 18:00
      • Вт 09:00 До 18:00
      • Среда 09:00 До 18:00 ЧТ
      • :
      • : AM До 18:00
      • ПТ 09:00 До 18:00
      • Суббота 09:00 До 18:00
      • Вс Праздник

      PCS HI-CARE специализируется на комплексной борьбе с вредителями.Мы предоставляем технические консультации широкому кругу коммерческих клиентов, включая, помимо прочего, производителей продуктов питания, гостиниц и индустрии развлечений, застройщиков, фирм по управлению объектами, строительных подрядчиков и консультантов. Мы предоставляем такие услуги, как общая борьба с вредителями, борьба с тараканами, борьба с термитами, борьба с мухами, борьба с грызунами и т. д. * БЕСПЛАТНО (Контроль грызунов) * ROACH OUT (Борьба с тараканами) * FLYAWAY (управление полетом) * ANTSTOPPER (управление муравьями) * BUXNETTER (постельный клоп) * УХОД ЗА ТЕРМИТАМИ (контроль термитов) * ПОСЛЕСТРОИТЕЛЬНЫЙ ТЕРМИТНЫЙ КОНТРОЛЬ * ПРЕДВАРИТЕЛЬНЫЙ ТЕРМИТНЫЙ КОНТРОЛЬ+ Подробнее


      Премиум

      • Нам доверяют пользователи
      • Подлинное объявление

      Это известное заведение действует как универсальный пункт назначения, обслуживающий клиентов как местных, так и из других частей Эрнакулама.За время своего существования этот бизнес прочно закрепился в своей отрасли. Вера в то, что удовлетворенность клиентов так же важна, как и их продукты и услуги, помогла этому заведению … собрать обширную базу клиентов, которая продолжает расти с каждым днем. В этом бизнесе работают люди, которые преданы своим ролям и прилагают много усилий для достижения общего видения и более крупных целей компании. В ближайшем будущем этот бизнес стремится расширить линейку продуктов и услуг и обслуживать более широкую клиентскую базу.Персонал в этом заведении вежливый и моментальный в оказании любой помощи. Они с готовностью ответят на любые вопросы или вопросы, которые вы m+ Подробнее


      Премиум

      • Доверие пользователей
      • Подлинный листинг

      APCO руководствуется желанием быть известным как поставщик услуг, а также как поставщик решений. Он стремится предоставлять клиентам комплексные решения высокой степени, которые включают как традиционные, так и экологические методы, а также информируют их о превентивных аспектах борьбы с вредителями.APCO считает, что влияние, которое мы все оказываем на окружающую среду, не следует воспринимать легкомысленно. В APCO мы серьезно относимся к этому и стремимся оказывать услуги с наименьшими последствиями при каждом столкновении с вредителями. APCO обеспечивает действительно беспроблемный опыт. Наши услуги включают в себя традиционные, экологически чистые решения, а также решения, не содержащие пестицидов, и благодаря нашему продуманному подходу у нас действительно есть что-то для каждого. Управляется командой профессионалов Стремление обеспечить высокую степень интегрированных решений Ознакомиться с профилактическими аспектами борьбы с вредителями+ Подробнее 18:30

    • ВТ 09:00 До 18:30
    • Среда 09:00 До 18:30
    • ЧТ 09:00 До 18:30
    • ПТ 09:060: 30 PM
    • СБ 09:00 До 18:30
    • ВС 09:00 До 18:30

    Услуги по борьбе с вредителями Грызуны, Услуги по борьбе с вредителями, Домашняя борьба с вредителями, Коммерческая служба борьбы с вредителями, Услуги по борьбе с вредителями муравьи, термиты Борьба с вредителями, Бытовая служба дезинсекции, Борьба с вредителями, услуги дезинсекции тараканов, Дезинсекция Услуги Офисы, Roden дезинсекция, дератизация гостиницы, Дезинсекция продуц… дилеры, Борьба с сельскохозяйственными вредителями, Служба борьбы с вредителями в жилых помещениях, Общая борьба с вредителями.+ Больше


    Сегодня (круглосуточно) Открыто сейчас Круглосуточно
    • ПН Открыто круглосуточно
    • Вт Открыто круглосуточно
    • СР Открыто круглосуточно часов
    • ЧТ Открыто круглосуточно
    • ПТ Открыто круглосуточно
    • СБ Открыто круглосуточно
    • ВС Открыто круглосуточно

    Правительство Индии, см. уведомление от 23 марта 1968 г. возложило на CWC дополнительную ответственность его склады.CWC предоставляет качественные услуги по борьбе с вредителями (PCS), т. е. общие услуги по дезинсекции, дезинфекцию от микробов и микробов (вирусов, бактерий и грибков), обработку от термитов, грызунов, комаров, борьбу с сорняками и т. д. своим различным клиентам в государственный и частный секторы на основе PAN India. CWC также оказывает услуги по дезинфекции для профилактики вируса Короны. CWC с более чем 60-летним опытом предоставляет бесперебойные услуги различным клиентам, таким как железные дороги, авиакомпании, администрация аэропортов Индии, больницы, банки, университеты, IIT, IIM, BHEL, BEL, HAL, HCL, GAIL, национальные музеи, научные центры. и другие БП.Мы сертифицированы по стандарту ISO 9+ Подробнее часов

  • СБ Открыто 24 часа
  • ВС Открыто 24 часа
  • Центральная складская корпорация (предприятие правительства Индии), пионер в области складирования, также предоставляет услуги по дезинфекции / дезинфекции по запросу наших уважаемых клиентов от угрозы заражения вредителями и микробами.В связи со вспышкой пандемии COVID-19 CWC предоставляет услуги по дезинфекции широкому кругу клиентов, включая различные правительственные учреждения. Организации, промышленные предприятия и банки. Нашими известными клиентами являются различные министерства, PSU, государственные / центральные правительственные учреждения, железные дороги, корабли, самолеты, контейнеры, университеты, больницы, GAIL, информационный парк, верфь в Кочине и т. д., и во время этой вспышки Covid-19 мы несли дезинфекцию самолетов Air India Express, доставляющих репатриантов из зарубежных стран.Помимо вышеперечисленного , CWC также проводит следующие процедуры . :30–17:30

  • Ср. 09:30–17:30
  • , ЧТ 09:30–17:30
  • ПТ 09:30–17:30
  • : СБ0 0 AM До 17:30
  • SUN Праздник
  • Центральная складская корпорация (CWC) является центральным правительством.ПГУ при Министерстве Работа с потребителями, продукты питания и общественное распространение. Это единственная CPSE, которая обеспечивает дезинфекцию и общие услуги по борьбе с вредителями (PCS), то есть дезинфекция против микробов и микробов (вирусы, бактерии и грибки) и обеззараживание от термитов,… грызунов, комаров, птиц, нежелательной растительности и т. д. Группа по борьбе с вредителями центрального склада стремится безопасно и эффективно решать проблемы борьбы с вредителями в жилых, коммерческих и промышленных районах Коччи и его окрестностей.Специально обученные и квалифицированные технические специалисты незаметно приедут к вам и предоставят оценку и рекомендации экспертов по базовым планам борьбы с вредителями. Программы подбираются под ваш бюджет. Предлагаемые услуги 1. Дезинфекция для предотвращения ковид 19 2. F+ More


    Сегодня (с 09:00 до 18:00) Закрыто в любое время
    • ПН с 09:00 до 18:00
    • Вт с 09:00 до 18:00
    • Ср
    • :00–18:00
    • ЧТ 09:00–18:00
    • ПТ 09:00–18:00
    • СБ 09:00–18:00
    • : 00 AM До 18:00

    Услуги по борьбе с вредителями Грызуны, Услуги по борьбе с вредителями, Жилые услуги по борьбе с вредителями, Коммерческие услуги по борьбе с вредителями, Услуги по борьбе с вредителями муравьи, термиты Борьба с вредителями, Бытовые услуги по борьбе с вредителями, Борьба с вредителями, Услуги по борьбе с вредителями таракан, Вредители дезинсекционные услуги Офисы, Roden борьба с вредителями, услуги дезинсекции Гостиница, Дезинсекция продуц… дилеры, Борьба с сельскохозяйственными вредителями, Служба борьбы с вредителями в жилых помещениях, Общая борьба с вредителями.+ Больше


    Сегодня (круглосуточно) Открыто сейчас Круглосуточно
    • ПН Открыто круглосуточно
    • Вт Открыто круглосуточно
    • СР Открыто круглосуточно часы
    • ЧТ Открыто круглосуточно
    • ПТ Открыто круглосуточно
    • Суббота Открыто круглосуточно
    • ВС Открыто круглосуточно

    Наша компания овладела искусством предоставления услуг по борьбе с вредителями в штате Керала и Тамил Наду.Борьбу с вредителями выполняют наши специалисты, обладающие всеми необходимыми знаниями и навыками в этой отрасли. Эта услуга специально предоставляется с помощью первоклассных химикатов и современных технологий в соответствии с установленными промышленными нормами. Мы предоставляем свои услуги по дезинсекции в кохине и прилегающих помещениях. Блохи. Клещи. Серебряная рыбка. Тараканы. Пчелы. Муравьи. Мышей. Крысы. Домашние вредители могут быть чем-то большим, чем просто неприятностью – они могут стать угрозой для вашего имущества и, возможно, для вашего здоровья.Фактически, одна домашняя мышь может заразить в десять раз больше пищи, чем съест. Вот почему борьба с вредителями и насекомыми так важна в вашем доме. Узнайте, как борьба с вредителями от ECO PEST INDIA может помочь решить ваши проблемы с вредителями. Чт Открыто круглосуточно

  • ПТ Открыто круглосуточно
  • Суббота Открыто круглосуточно
  • Вс Открыто круглосуточно
  • У нас есть современное оборудование и команда опытных профессионалов, что позволяет нам предоставлять все наши услуги в соответствии с требованиями и запросами наших клиентов.Во время выполнения наша команда учитывает точный бюджет наших престижных клиентов, чтобы достичь их максимального уровня удовлетворения. Эти услуги … реализуются высококвалифицированными и способными сотрудниками, которые хорошо осведомлены об установленных отраслевых принципах, которые помогают оказывать эти услуги на высоком уровне. Эти услуги пользуются большим спросом у наших клиентов благодаря своевременному выполнению и доступным ценам. Оказывая услуги, мы заботимся о том, чтобы клиенты всегда были удовлетворены нами и соответствовали потребностям клиентов.Услуги выполняются с использованием современных методик + Подробнее


    Сегодня (с 09:30 до 19:00) Выходной Круглосуточно
    • ПН 09:30 До 19:00
    • Вт 09:30 До 07 :00 PM
    • СРЕДА 09:30 До 19:00
    • ЧТ 09:30 До 19:00
    • ПТ 09:30 До 19:00
    • СБ 09:30: 0 До PM
    • ВС с 09:30 до 19:00

    Мы являемся высококвалифицированными экспертами по борьбе с вредителями, расположенными в Коччи.Мы предоставляем отличные услуги по борьбе с термитами и другим проблемам, связанным с почтой. 20:00

  • Ср 09:00 До 20:00
  • Чт 09:00 До 20:00
  • Пт 09:00 До 20:00
  • Суббота До 09:08: 00 PM
  • ВС С 09:00 до 20:00
  • Eco Pest India, в настоящее время являющаяся подразделением Aindhriya Private Limited, базируется в Керале и начала свою деятельность в 2013 году.Мы предлагаем широкий спектр услуг по борьбе с вредителями самым быстрым, дешевым и безопасным способом. МИССИЯ Наша миссия состоит в том, чтобы быть одним из самых уважаемых поставщиков услуг и увеличить долю рынка, лояльность клиентов, добиться улучшения работы и системы, удовлетворенности клиентов и уменьшить жалобы на долгосрочный рост. ОПЫТ Мы являемся признанной компанией вместе с нашей динамичной командой хорошо обученных, преданных своему делу профессиональных и сертифицированных сотрудников для предоставления высококачественных услуг.МЕТОДЫ ОБУЧЕНИЯ У нас есть информативные методы обучения, которые включают видео, рабочие тетради, которые помогают нашим сотрудникам работать более эффективно. Мы стремимся постоянно совершенствоваться и создавать инновационные идеи.+ Подробнее До 20:00

  • Ср 09:00 До 20:00
  • Чт 09:00 До 20:00
  • Пт 09:00 До 20:00
  • Суббота До 09:080 :00 PM
  • ВС 09:00 До 20:00
  • ДОСТУПНЫ ВСЕ СЛУЖБЫ…. КОНТРОЛЬ ТЕРМИТОВ, КОНТРОЛЬ МУРАВЬЕЙ, КОНТРОЛЬ ГРЫЗУНОВ, КОНТРОЛЬ ТАРАКАНОВ..


    Сегодня (круглосуточно) открыто сейчас круглосуточно
    • ПН открыто круглосуточно
    • вт открыто круглосуточно
    • СР открыто круглосуточно
    • 4
    • ПТ Открыто 24 часа
    • Суббота Открыто 24 часа
    • Вс Открыто 24 часа

    WE ARE предлагает широкий спектр высококачественных, экологически чистых и индивидуальных коммерческих и товарных услуг по борьбе с вредителями, Pan India.Наша команда технических экспертов гарантирует, что вы получите наиболее подходящее и практичное, экологически безопасное решение для борьбы с вредителями, которое призвано устранить ваши риски, связанные с вредителями. … Эта служба борьбы с вредителями очень эффективна и проста. Сила службы борьбы с вредителями: • Квалифицированный и опытный персонал • Услуги, соответствующие стандарту качества и питания • Индивидуальные решения • Руководство по профилактическим мерам • Общенациональная сервисная сеть. О нас Наши услуги включают обработку от обычных вредителей, таких как муравьи, мухи, тараканы, гекконы (ящерицы), комары, грызуны, чешуйницы, пауки, насекомые, термиты, сорняки и жуки-древоточцы.+ Еще


    Сегодня (с 09:00 до 22:00) Закрыто в любое время
    • ПН с 09:00 до 22:00
    • Вт с 09:00 до 22:00
    • : СР 0 AM До 22:00
    • ЧТ 09:00 До 22:00
    • ПТ 09:00 До 22:00
    • СБ 09:00 До 22:00
    • 3 ВС
    • 5 P09est 9076 6 Праздник 9076 control kochi базируется в Керале и начала работу в 2013 году. Мы предлагаем широкий спектр услуг по борьбе с вредителями самым быстрым, дешевым и безопасным способом.МИССИЯ Наша миссия состоит в том, чтобы быть одним из самых респектабельных поставщиков услуг и увеличивать долю рынка, лояльность клиентов, добиваться улучшения работы и системы, удовлетворенности клиентов и уменьшать жалобы на долгосрочный рост. ОПЫТ Мы являемся признанной компанией вместе с нашей динамичной командой хорошо обученных, преданных своему делу профессиональных и сертифицированных сотрудников для предоставления высококачественных услуг. МЕТОДЫ ОБУЧЕНИЯ У нас есть информативные методы обучения, которые включают видео, рабочие тетради, которые помогают нашим сотрудникам работать более эффективно.Мы стремимся постоянно совершенствоваться и создавать инновационные идеи.+ Подробнее До 23:30
    • Ср 09:00 До 23:30
    • Чт 09:00 До 23:30
    • Пт 09:00 До 23:30
    • Сб 09:00 :30 PM
    • ВС 09:00 До 23:30

    Pest Control kochi базируется в штате Керала и начала работу в 2013 году.Мы предлагаем широкий спектр услуг по борьбе с вредителями самым быстрым, дешевым и безопасным способом. МИССИЯ Наша миссия состоит в том, чтобы быть одним из самых уважаемых поставщиков услуг и увеличивать долю рынка, лояльность клиентов, добиваться улучшения работы и системы, удовлетворенности клиентов и уменьшения количества жалоб на долгосрочный рост. ОПЫТ Мы являемся признанной компанией вместе с нашей динамичной командой хорошо обученных, преданных своему делу профессиональных и сертифицированных сотрудников для предоставления высококачественных услуг.МЕТОДЫ ОБУЧЕНИЯ У нас есть информативные методы обучения, которые включают видео, рабочие тетради, которые помогают нашим сотрудникам работать более эффективно. Мы стремимся постоянно совершенствоваться и создавать инновационные идеи.+ Подробнее До 18:00

  • Ср 09:00 До 18:00
  • Чт 09:00 До 18:00
  • Пт 09:00 До 18:00
  • Суббота До 09:060 :00 PM
  • SUN  Holiday
  • Борьба с вредителями и уборка Борьба с термитами (до и после) Борьба с муравьями Борьба с тараканами Борьба с крысами Борьба с постельными клопами Борьба с мухами Борьба с ящерицами Борьба с древесными мотыльками Борьба с комарами И все другие общие услуги по борьбе с вредителями и уборке Наши услуги доступны по всей Керале. Мы предоставляем 7 лет гарантии


    Мы предоставляем услуги по борьбе с вредителями для термитов, тараканов, грызунов, ящериц и т. д. и с использованием сертифицированных химикатов HACCP.


    Сегодня (с 09:00 до 19:00) Закрыто в любое время
    • ПН 09:00 – 19:00
    • Вт 09:00 – 19:00
    • : Ср 0 До утра 09 19:00
    • ЧТ 09:00 До 19:00
    • ПТ 09:00 До 19:00
    • СБ 09:00 До 19:00
    • ВС Праздник
    • Завершить Control Solutions


      Сегодня (с 00:00 до 12:00) Закрыт в любое время
      • ПН с 12:00 до 12:00
      • Вт с 00:00 до 12:00

      • : Ср00 AM До 12:00
      • ЧТ 12:00 До 12:00
      • ПТ 12:00 До 12:00
      • СБ 12:00 До 12:00
      • ВС 00 До 12:00 12:00 PM

      Качество химикатов: мы используем безопасные для человека химикаты.Химикат нового поколения без запаха и ISI, одобренный ВОЗ химикат. Качество технических специалистов: все специалисты по обслуживанию должным образом обучены и имеют многолетний опыт работы. Наши услуги: Наше качество и надежность обязывают нас предоставлять такую ​​же ценность..

    Добавить комментарий

    Ваш адрес email не будет опубликован.