Универсальный праймер: 3M™ Универсальный Праймер УФ, 946 мл

Содержание

Праймер Универсал-2К-4060 (Universal-2K) — Сертификаты, отзывы, технические характеристики, цены

Праймер Универсал-2К предназначен для проведения грунтовки – нанесения предварительного, выравнивающего слоя перед использованием мастик Гипердесмо.   Мастики применяются для таких задач как:

  • создание гидроизоляции труб,  инженерных коммуникаций и узлов,
  • создание водостойкого герметичного покрытия крыш битумнополиуретановой защитой
  • антикоррозийная защита
  • защита от «выгорания» под действием ультрафиолета различных поверхностей, защита цвета
  • и ряд других

Качество работ зависит, во многом, от того, насколько грамотно проведены подготовительные работы, насколько качественно поверхность очищена и обработана перед нанесением мастик. Если эта «черновая» работа не проведена, или проведена не качественно – то ни один, даже самый лучший герметик, не обеспечит надежный результат, поскольку не будет обеспечиваться нужная адгезия – сцепление мастики с основой, она не сможет проникнуть в материал на нужную глубину. При этом, одним из важных требований подготовки является нанесение мастики на высушенную – обезвоженную поверхность.

Праймер Универсал-2К создан, чтобы сделать подготовительные работы проще, сэкономить ваше время и силы, и при этом добиться максимального, долговечного результата  Грунтовка позволяет обеспечить наилучшую адгезию мастики и основы.

Праймер Универсал-2К   — это современный полностью полимерный материал, созданный на основе полиуретановых смол. Благодаря удачно подобранной формуле, он обладает рядом полезных качеств, которые выгодно выделяют его на фоне многих других:

  • может наноситься на влажную поверхность – вам останется только очистить ее от жира и отслаивающихся частиц
  • повышенная адгезия – даже выше, чем предполагает европейский стандарт качества!
  • быстрая полимеризация – можно начинать работать уже через несколько часов
  • праймер является универсальным — это грунт не только под полимерные, но и эпоксидные, полимерцементные, битумные покрытия,  и даже — акриловые краски
  • может наноситься на большинство поверхностей: бетон, свежий бетон, металл, пластик, плитка, камень, кирпич и другие.
  • может использоваться как клеящий слой между различными поверхностями —  соединение слоев старого и нового бетона и т.п.
  • может использоваться для работы с геотекстилем
  • не содержит опасных для дыхания растворителей,– работа с ним максимально безопасна
  • работает при низких температурах

Важно:

  • Для увеличения времени полимеризации можно добавить растворитель Ксилол
  • При нанесении на влажные основания грунт не рекомендуется разбавлять
  • При работе с пластиком нужно соблюдать осторожность – разные сорта пластика могут вести себя по-разному при взаимодействии с данным полимером, перед началом работ – протестируйте, чтобы добиться нужного результата и не повредить поверхность.

Праймер Грида грунт акриловый универсальный 10кг канистра, морозост.

Праймер Грида акриловый универсальный 10л канистра

Назначение
Акриловый грунт предназначен для базовой обработки большинства поверхностей, таких как кирпич, штукатурка, гипсокартон, дерево, цемент, бетон и пенобетон и т.д. Грунт существенно уменьшает расход финишных покрытий, улучшает сцепление с дальнейшими материалами и минимизирует впитывающую способность основания. Обеспечивает высокое качество, долговечность и равномерность цвета финишного покрытия.
С добавками против плесени, обладает антисептическим действием, предотвращает рост бактерий, грибков и плесени.

Применяется для наружных и внутренних работ.

Технические характеристики
Расход на 1 слой: 100-120 г/м² в зависимости от рельефа и впитывающей способности поверхности.

Время высыхания грунтовки при температуре (20±2)°С и относительной влажности воздуха (65±5)%- между слоями – 2-4 часа. Полное высыхание-24 часа. При прохладных температурах и повышенной влажности время высыхания увеличивается.

Цвет: белый, после высыхания бесцветный

Подготовка поверхности к нанесению:
Свежие бетоны, цементы, штукатурки и шпаклевки должны полностью высохнуть;
Поверхности, ранее покрытые мелом или известковыми красками, должны быть очищены до полного удаления мела и остатков краски;
Основание должно быть очищено от осыпающихся и отслаивающихся участков, пыли, жира и других загрязнений, ухудшающих сцепление и проникающую способность грунтовки.
Нанесение акрилового грунта:
Перед применением тщательно перемешать. Грунтовку следует применять при температуре окружающего воздуха не ниже +5ºС и не выше +40ºС. Наносить при помощи малярной кисти, валика или методом пневматического распыления в два прохода с интервалом 2-4 часа.

Грунт с маркировкой зимняя или морозостойкая выдерживает 5 циклов заморозки до -25ºС. Размораживать при комнатной температуре.

Срок годности и хранения: 12 месяцев со дня изготовления, при условии соблюдения требований транспортировки и хранения.

Состав: водная акриловая дисперсия, антисептик, вода, целевые добавки.

Праймер универсальный Polyprime 100 — Гидроизоляция

Праймер Polyprime 100  компонент А  — Модифицированный Дифенилметан Диизоцианат, жидкость коричневого цвета. Специально созданный для реагирования с влагой и полимеризации в основании без дополнительных реагентов. Пропорции смешивания с компонентом В — 50/50. При увеличенном содержании влаги в основании, содержание компонента А в смеси должно быть увеличено до пропорции 60% комп.А/40% комп.В.

Праймер Polyprime 100  компонент В — это прозрачного цвета три-эстер глицерин, который вступает в реакцию с компонентом А и обеспечивает химическую адгезию полимочевинных эластомеров к основанию.

Полипрайм Экстендер (П.П.Э.) — это циклический органический эстер, который вступает в реакцию с обеими компонентами и предотвращает выделение органических летучих веществ после полной полимеризации. П.П.Э. может быть применен для увеличения времени полимеризации смеси.

Особенности и область применения Праймера Полипрайм 100

  • Полипрайм-100 обладает повышенными инфильрационными свойствами и глубоко проникает в бетонную/цементно-песчаную стяжку, запечатывает поверхность бетона и исключает порообразование при нанесении полимочевины!

  • В отличие от многих других грунтовочных материалов имеет гидрофобные свойства и поэтому слабо взаимодействует с влажными или холодными поверхностями. При условии пропорции смешивания 60% компонента А к 40% компонента В можно наносить грунт Полипрайм-100 на бетон с влажностью до 15%.

  • Грунт Полипрайм-100 следует применять для подготовки бетонных поверхностей перед нанесением Полимочевинных эластомеров для создания повышенных физико-химических адгезионных связей.

  • Полипрайм-100 это универсальный праймер и может использоваться как по бетону, так и по рулонным покрытиям, металлическим поверхностям, ПВХ и ЭПДМ мембранам, шиферу и фанере, для защиты ППУ.

  • Высохший материал обладает янтарным, слегка глянцевым цветом.

 

Характеристики мокрого слоя праймера Полипрайм 100

Твердых веществ по объему

100%

Твердых веществ по весу

100%

Летучие органические вещества

0

Укрывистость материала

10,0м²/0,1мм/литр

Вес на литр

Приблизительно 1,05 кг

Вязкость (циклов в секунду при 77° F (25 °C)

Компонент A: прибл.

Компонент B: прибл.

Время отверждения

           Гель

С добавлением 10% П.П.Э.

Остаточная липкость

С добавлением 10% П.П.Э.

Очищающий растворитель

Разбавитель

       10-15 мин. при 25ºС

       30-40 минут

       4-6 часов при 25ºС

       6-20 часов

       DPM, NMP, Polyclean

       Не используется

Рекомендации по нанесению праймера Полипрайм 100

Смешать установленный объем Компонента А с Компонентом В в пропорции 1:1 и непрерывно мешать в течении 2 минут. Если необходимо добавить П.П.Э. (не более 10% от объема), то смесь необходимо снова тщательно перемешать.

Внимание: Не добавлять новый материал к предварительно прореагировавшему праймеру! Не смешивать материала больше, чем можно нанести до начала полимеризации!

  • Наносить праймер щеткой или валиком, тщательно втирая в основание.

  • Если для нанесения праймера применяется оборудование с дозированием компонентов 1:1, температура подогрева компонентов в шлангах должна быть установлена на 43-54ºС.

Полипрайм-100 это грунт для тех, кто устал бороться с кратерами!

Универсальный морозостойкий праймер из битума AquaMast

ТЕХНОНИКОЛЬ запустила производство универсального морозостойкого битумного праймера AquaMast. Праймер создан специально для частного домостроения и применяется для подготовки поверхности перед гидроизоляцией фундаментов, кровель, а также полов внутри здания, в том числе в жилых помещениях. Он улучшает сцепление гидроизоляции с основанием и позволяет быстро и качественно провести подготовительный этап без привлечения помощи профессионалов.

Основные сферы применения:

  • проведение подготовительных работ внутри и снаружи помещений;
  • праймирование цементно-песчаных, бетонных и других впитывающих поверхностей перед укладкой наплавляемых, самоклеящихся кровельных и других битумных гидроизоляционных материалов;
  • обеспечение адгезии гидроизоляционного покрытия с основанием и снижения риска вздутий или отслоений покрытий.

Универсальный морозостойкий битумный праймер AquaMast представляет собой водную эмульсию нефтяного битума, модифицированного технологическими добавками. В его составе нет растворителя, это означает, что он абсолютно безопасен для человека и окружающей среды и может использоваться при проведении как наружных, так и внутренних работ. Важное преимущество новинки — экономическая доступность. Праймер не только отличается ценой, на фоне аналогов он выделяется рациональным расходом. В зависимости от основания расход составляет от 0,15 кг/². Таким образом, одного ведра весом 15 кг хватит для огрунтовки до 100 м² поверхности. При нормальной температуре окружающего воздуха время полного высыхания праймера составляет не более часа. Это означает, что фактически сразу после подготовки основания можно приступать к следующим этапам монтажных работ.

Универсальный битумный праймер AquaMast применяется при широком диапазоне температур — от 0 °С до +40 °С. При этом важно, чтобы перед нанесением температура самого праймера была от 0 °С и выше, а температура основания выше +5 °С, чтобы исключить нанесение материала на лед или иней. Еще одна важная черта новинки — морозостойкость. В процессе транспортировки и хранения допускается снижение температуры праймера ниже −5 °С на срок не более трех дней. Благодаря данному свойству удалось упростить хранение и перевозку продукта в холодное время года.

Rio Profi Универсальный бескислотный праймер, 15 мл

Расширенный поиск

Название:

Артикул:

Текст:

Выберите категорию:

Все Тестовые наборы LIKE BACK » Гель-лаки »» Water »» OneLove Однослойные гель-лаки »» GLOW »» Melange »» Bunny plush »» Splash »» REFLEXION »» EXPLOSIVE »» Harle Quin »» Astral »» Ballerina »» Unicorn »» 5 Element »» Purpur »» Twinkling »» Mustard »» Lemon »» Violet »» Sky »» Olive »» Оcean »» Lavender »» Indigo »» Forest »» Dusty Rose »» Carida »» Cappuccino »» Blush »» Blueberries »» Berry Mix »» Barbie »» Asphalt »» BLACK / WHITE » Жидкости » Камуфлирующие базы » Базы и Топы » Стемпинг » Акрил гели » Твердая термо-пудра Rio Profi » Rio Profi Базы, камуфлирующие базы, топы, праймеры, бондеры »» Базы »» Топы »» Праймеры »» Камуфлирующие покрытия »» Бондеры » Rio Profi Жидкости »» Rio Profi Жидкости для снятия гель-лака, геля, биогеля и т.д. »» Rio Profi Жидкости для обезжиривания ногтей и снятия липкого слоя » Rio Profi Гель-лаки »» Rio Profi Гель-лак Marmalade »» Rio Profi гель-лак 3D Fire Work »» Rio Profi Гель-лак Металлик 3D »» Rio Profi Магнитный гель-лак 5D «Platinum effect» »» Rio Profi Гель-лаки Pepper »» Rio Profi Гель-лаки London »» Rio Profi Гель лаки серия Xenon »» Rio Profi Гель-лаки Star Galaxy »» Rio Profi Классическая серия »» Rio Profi Гель-лаки Pod Kablukom »» Rio Profi Гель-лаки YUKI »» Rio Profi Гель-лаки Neon Effect »» Rio Profi Гель-лаки Divine glitter »» Rio Profi Гель-лаки Diamond »» Rio Profi Гель-лаки Dusty »» Rio Profi Однофазные гель-лаки One Step »» Rio Profi Гель-лаки Cat Eye »» Rio Profi Сияющий Магнитный гель-лак »» Rio Profi Гель-лаки Chameleon »» Rio Profi Гель-лаки Северное сияние »» Rio Profi Гель-лаки Grey »» Rio Profi Гель-лаки Fantasy »» Rio Profi Гель-лаки Red Love »» Rio Profi Гель-лаки Flower »» Rio Profi Гель-лаки Nude Shine »» Rio Profi Гель-лаки Pastel »» Rio Profi Гель-лаки Metallic Effect »» Rio Profi Гель-лаки Cat Eye 3D »» Rio Profi Набор гель-лаков Кошачий глаз + Витраж »» Rio Profi Гель-лаки SNOW »» Rio Profi Гель-лаки Lady French »» Rio Profi Diamond Luxury Gel »» Rio Profi Гель-лаки Halo »» Rio Profi Гель-лаки Nude »» Rio Profi Гель-лаки Sea Pearl »» Rio Profi Гель-лаки Витраж »» Rio Profi Гель-лаки Тermo NEW »» Rio Profi Гель-лаки Royal Purple »» Rio Profi Гель-лаки Nude Royal »» Rio Profi Набор гель-лаков Mystic »» Rio Profi Гель-лаки Business Woman »» Rio Profi BSGel Lux »» Rio Profi Гель-лаки Siberian Queen »» Rio Profi Гель-лаки Deep » Rio Profi Акриловая и гелевая технологии; Acrylic Gel »» Rio Profi Камуфлирующая пудра »» Rio Profi Акриловая технология »» Rio Profi Камуфлирующие гели »» Rio Profi Гелевая технология »» Rio Profi Acrylic Gel в банке » Rio Profi Гель-краски,гель-пасты, гель-пластилин и гели для дизайна »» Rio Profi Гель для дизайна Décor Gel Super Star »» Rio Profi Гель для дизайна Gel Flow Safari »» Rio Profi Гель-паста Art Deco Spider Паутинка »» Rio Profi Гель для дизайна Melting Gel »» Rio Profi Гель-краска и Термо-краска »» Rio Profi Гель-паста »» Rio Profi Гель-пластилин » Rio Profi Дизайн »» Rio Profi Фольга для дизайна »»» Rio Profi Фольга для литья »»» Rio Profi Фольга тонкая лента в рулоне »»» Rio Profi Фольга для дизайна Битое стекло »»» Rio Profi 3D фольга Хамелеон »»» Rio Profi Наборы переводной фольги »» Rio Profi Слайдер дизайн »»» Rio Profi Слайдер дизайн 3D »»» Rio Profi Слайдер дизайн серия 3Dcrystal »»» Rio Profi Слайдер дизайн DEEP DESIGN »»» Rio Profi Слайдер дизайн серия Galaxy »»» Rio Profi Слайдер дизайн белое кружево »»» Rio Profi Слайдер дизайн MINX фольгированный »»» Rio Profi Слайдер дизайн на белой подложке »»» Rio Profi Слайдер дизайн Pedicure »» Rio Profi Стразы, хрустальная крошка, бульонки, nail-дизайн »»» Rio Profi Nail Дизайн в банке »»» Rio Profi Nail Дизайн MIX MAX »»» Rio profi Ювелирные стразы, объемные украшения из страз, стразы в карусели »»» Rio Profi Стразы в пакете »»» Rio Profi Стразы Swarovski »»» Rio Profi Хрустальная крошка »»» Rio Profi Бульонки »»» Rio Profi Дизайн для ногтей »» Rio Profi Зеркальная втирка, пудра; пигмент жемчужный »»» Rio Profi Зеркальная пудра Хамелеон »»» Rio Profi Зеркальная пудра эффект Хрома »»» Rio Profi Зеркальная втирка Микроблеск »»» Rio Profi Голографическая пудра HOLOGRAPHIC POWDER PEACOCK »»» Rio Profi Пигмент жемчужный »»» Rio Profi Зеркальная втирка Chrome »»» Rio Profi Втирка Нить-Хром »» Rio Profi Краска, пластины и наборы для стемпинга »» Rio Profi Камифубуки (конфетти), шестигранники »» Rio Profi Мармелад, бархатный песок и пигмент »» Rio Profi Акриловая цветная и термо пудра для дизайна ногтей »» Rio Profi Флок, слюда, хлопья ЮККИ для дизайна »» Rio Profi Снежное конфетти »» Rio Profi Дизайн Снежинки »» Rio Profi Звездная россыпь »» Rio Profi Клей для типс, страз и фольги »» Rio Profi Чешуя Дракона »» Rio Profi Золотая лихорадка »» Rio Profi Металлический Декор Микс »» Rio Profi Дизайн-мозаика » Rio Profi Средства для маникюра и педикюра; масла для кутикулы; лечебная серия для ногтей »» Rio Profi Средства для маникюра и педикюра »» Rio Profi Масла для кутикулы »» Rio Profi Лечебная серия и корректоры для маникюра » Rio Profi Уходовая серия и парафинотерапия » Rio Profi Материалы для бровей и ресниц » Rio Profi LED лампы для маникюра Ange by Rio Profi » Ange Базы и топы » Ange Гель-лаки »» Ange Классическая серия »» Ange Серия Sand Cats Eye »» Ange Серия Powder »» Ange Серия 4 SEASONS »» Ange Cерия Disco Style Rio Profi Расходные материалы Rio Profi Инструменты для маникюра и педикюра » Rio Profi Инструменты для педикюра » Rio Profi Кисти и наборы кистей »» Rio Profi Кисти для геля и акрила »» Rio Profi Кисти для дизайна и гель-лака »» Rio Profi Наборы кистей » Rio Profi Бафы, пилочки, шлифовки, керамические удалители кутикулы, кисти и щетки для опила » Rio Profi Насадки для маникюра » Rio Profi Профессиональные инструменты для ногтей Rio Profi Депиляция » Rio Profi Сахарная паста для шугаринга » Rio Profi Воскоэпиляция » Rio Profi Средства для шугаринга и воскоэпиляции Rio Profi Макияж Rio Professional СТАРТОВЫЕ НАБОРЫ ДЛЯ ДЕПИЛЯЦИИ СТАРТОВЫЕ НАБОРЫ ДЛЯ МАНИКЮРА Rio Prifi Body Line Rio Profi Crazy Fruit Rio Profi Hair Line Rio Profi Face Line Rio Profi BB Brow

Производитель:

ВсеAcmeAdidasAgent ProvocateurAHAVAAMDANTAAntonio BanderasAppleArmand BasiBTCBurberryBvlgariCacharelCalvin KleinCarolina HerreraCerrutiChanelContinentalCrocsCrosbyDC ShoesDefenderDellDisneyGreenlandHlavinHPHTCINCITYINTELJurassic SPAK&KKangaROOSKeraSysKFZKorresLenovoLGLogitechMerrellMezaguzMichelinMONDIGOMonster HighMy Little PonyNeohitNikeNokiaNOVAPantechParityPULANNARenaissanceRene FurtererRichterRioProfiRubber DuckRugearSamsungSTEFANO FERRISvenTargusTawas CrystalTexetTHOMAS MUNZTop SecretVitacciЗебраКристалл — ДеоНАТЛеоОбувь для всех ЛТДОбувьТрейдОдежда для всех ЛТДОдеждаТрейдПроизводитель №1Производитель №2Производитель №3ТВОЕТК Универсум

ШОК ЦЕНА:

Вседанет

Новинка:

Вседанет

Спецпредложение:

Вседанет

Результатов на странице:

5203550658095

Закрыть

Найти

Артикул: нет

Праймер выполняет функцию грунтовки перед нанесением материала на ноготь. Бывает кислотным (для наращивания гелем, акрилом), беcкислотным ( для гель лака), универсальный (для всех видов материала)

Способ применения:
— Обработайте ногти бафом (по направлению в одну сторону влево или вправо, открывая чешуйки ногтей).
— Обезжирьте специальной жидкостью для обезжиривания Rio Profi.
— Нанесите праймер тонким слоем в один раз. Несколько раз не проходите или чешуйки налягут друг на друга и сцепление с гель-лаком не произойдёт. Сохнет в течении 20 секунд на воздухе.
— Нанесите базу ( если лак или гель однофазный база не нужна).

Меры предосторожности: Хранить в недоступном для детей месте. При попадании в глаза  промыть водой.

Siberia Праймер-1 универсальный адгезионный грунт

Описание

Отлично подходит для подготовки к покраске сложных поверхностей, таких как стекло, винил, пластик, ламинат, кафельная плитка, порошковые покрытия и т.д.

Применение:
Для бытового, коммерческого и промышленного использования внутри и снаружи помещений на поверхностях, предназначенных для последующего нанесения на них водно-дисперсионных, алкидных, полиуретановых красок и эмалей.

Характеристики:
Образует белое шелковисто-матовое покрытие, быстро высыхает, легко шлифуется, имеет высокую адгезию к различным материалам, препятствует росту плесени,
ингибирует коррозию.

Подготовка поверхности:
обрабатываемая поверхность должна быть сухой и чистой. Глянцевые поверхности перед нанесением грунта слегка обработать наждачной бумагой мелкой
зернистости, удалить пыль.

Нанесение:
Перед применение тщательно перемешать состав. Нанесение производить валиком с коротким ворсом, кистью, воздушным или безвоздушным распылением, методом
Airmix.

Реставрация школьной доски:
1 Зашкурить основание наждачной бумагой мелкой зернистости, удалить пыль влажной тряпкой, высушить.
2 Нанести грунт Siberia Primer-1 в два слоя с интервалом 1 час, оставить высыхать еще на 1 час.
3 Нанести грифельную краску Siberia в два слоя.

Покраска сложных поверхностей — пластик, винил, стекло, керамика, ЛДСП.
1 Подготовить основание для нанесения — вымыть и обезжирить поверхность при необходимости.
2 Нанести грунт Siberia Primer-1 в два слоя с интервалом 1 час, оставить высыхать еще на 1 час.
3 Нанести финишную краску.

Грунт имеет выраженный, не резкий запах, который быстро выветривается.

Грунт нетоксичен, пожаровзрывобезопасен. При наружном контакте с глазами или слизистой оболочкой может вызывать раздражение. При случайном попадании промыть большим количеством воды.

Инструмент отмывать теплой водой непосредственно после применения, не допуская высыхания.

Транспортировка и хранение:
при температуре от +5°С до +30°С в плотно закрытой таре.

Внимание!
Данный грунт не предназначен для применения в качестве антикоррозионного покрытия!

Список универсальных праймеров

Универсальные праймеры представляют собой праймеры для ПЦР / секвенирования, которые связываются с последовательностью, обнаруженной во многих векторах клонирования плазмид, большинство из которых происходит из векторов pUC (которые, в свою очередь, происходят из pBR322). Эти последовательности были определены как хорошие сайты для ПЦР и секвенирования, поскольку они фланкируют сайт множественного клонирования, куда должна быть помещена встроенная последовательность ДНК.

9000 195
Название праймера Последовательность праймера

1

M13 Обратный (-27) 5′-GGA AAC AGC TAT GAC CAT G-3 ‘

73 2

73 2

73

M13 Вперед (-41) 5′-GGT TTT CCC AGTC ACG AC-3 ‘

3

M13 Вперед (-20) 5′-GTA AAA CGA CGG CCA GTG-3′

4

M13 Вперед (-21) 5′-TGT AAA ACG ACG GCC AGT-3 ‘

5

M13 Назад (-48) 5′-AGC GGA TAA CAA TTTC ACA C-3 ‘

6

SP6 5′-TAC GAT TTA GGT GAC ACT ATA G-3′

7

T3 5′- CAA TTA ACC CTC ACT AAA GG-3 ‘

8

T7 5′-TAA T AC GAC TCA CTA TAG GG-3 ‘

9

T7 EEV 5′-ATGTCGTAATAACCCCGCCCCG-3′

10

T7 Reverse 5′-TAGGTAGT

11

T7 Term 5′-GCT AGT TAT TGC TCA GCG G-3 ‘

12

pBluescript KS 5′-TCG AGG TCG ACG GTA TC-3′

13

pBluescript SK 5′-CGC TCT AGA ACT AGT GGA TC-3 ‘

14

3’pGEX 5′-CCG GGA GCT GCA TGT GTC AGA GG-3 ‘

15

5’pGEX 5′-GGG CTG GCA AGC CAC GTT TGG TG-3′

16

GST-Tag 5′-ACC CAA TGT GCC TGG ATG CG-3 ‘

17

pTrcHis-Forward 5′-GAG GTA TAT ATT AAT GTA TCG-3 ‘

18

pTrcHis-Reverse 5′-GAT TTA ATC TGT ATC AGG

CMV-вперед 5′-CGC AAA TGG GCG GTA GGC GTG-3 ‘

20

CMV-реверс 5′-AGT AGG AAA GTC CCG TAA GG-3′

21

EGFP-C 5′-CAT GGT CCT GCT GGA GTT CGT G-3 ‘

22

EGFP-N 5′-CGT CGC CGT CCA GCT CGA CCA -3 ‘

23

BGH-Reverse 5′-TAG AAG GCA CAG TCG AGG-3′

24

pQEproseq 5′-CCC GAA AAG TGC CAC CAC -3 ‘

25

pQErevseq 5′-GTT CTG AGG TCA TTA CTG G-3 ‘

26

Intein Forward 5′-CCC GCC GCT GCT TTT GCA CGT GAG-3′

27

5′-pBabe- Seq 5′-CTT TAT CCA GCC CTC AC-3 ‘

28

3′-pBabe-Seq 5′-ACC CTA ACT GAC ACA CATT CC-3′

29

-96 glll Праймер для секвенирования 5′-CCC TCA TAG TTA GCG TAA CG-3 ‘

30

GAL1 Forward 5′-AAT ATA CCT CTA TAC TTT AAC GTC-3 ‘

31

pBAD Forward 5′-ATG CCA TAG CAT TTT TAT CC-3′

32

pBAD Reverse 5′-GAT TTA ATC TGT ATC AGG

33

pTRE 3 ‘ 5′-CCA CAC CTC CCC CTG AAC- 3 ‘

34

pTRE 5′ 5′-CGC CTG GAG ACG CCA TCC-3 ‘

35

pYESTrp Forward 5′-GAT GTT AAC GAT ACC AGC C-3 ‘

36

pYESTrp Reverse 5′-GCG TGA ATG TAA GCG TGA C-3′

37

RVprimer3 5′-CTA GCA AAA TAG GCT GTC CC-3 ‘

38

Rvprimer4 5′-GAC GAT AGT CAT GCC CCG CG-3′

39

GLprimer 1 5′-TGT ATC TTA TGG TAC TGT AAC TG-3 ‘

40

GLprimer 2 5′-CTT TAT GTT TTT GGC GTC TTC CA-3′

41

SeqL-A (ATTL1) 5′-GCG AGA GTA GGG AAC TGC-3 ‘
900 03 42

SeqL-B (ATTL2) 5′-AAC ATC AGA GAT TTT GAG ACA C-3 ‘

43

SV40-pArev 5′-CCT CTA CAA ATG TGG TAT GG-3 ‘

44

SV40-Promoter 5′-GCC CCT AAC TCC GCC CAT CC-3′

45

U6 Primer 5′-GGG CAG GAA GAG GGC CTA T-3 ‘

46

Xpress Forward 5′-TAT GGC TAG CAT GAC TGG T-3′

47

EBV-Rev грунтовка 5 ‘ -GTG GTT TGT CCA AAC TCA TC-3 ‘

48

hU6-01 5′-GAG GGC CTA TTT CCC ATG ATT-3′

49

hU6-02 5′-TAA TTA GAA TTA ATT TGA CT-3 ‘

ПРАЙМЕР Montana 400 мл — Универсальный | MONTANA-CANS

Когда следует использовать грунтовку?

Целью грунтования является создание нейтральной поверхности, на которую можно наносить другие покрытия, которые будут иметь максимально возможный срок службы и наиболее эстетичную отделку по желанию.Грунтовки Montana предназначены для предварительной обработки и подготовки поверхностей и обеспечивают максимальную адгезию и защиту при нанесении на них последующих покрытий.

Когда мне использовать Montana PRIMER?

Montana PRIMER — это универсальные подготовители поверхности, которые можно использовать для обработки пластмасс, металла, пенополистирола, кожи, картона, дерева и многих других материалов. Мы предлагаем провести испытания на невидимой области вашего материала для проверки совместимости

Какой ПРАЙМЕР Montana и когда мне использовать?

Существует четыре различных грунтовки Montana PRIMER, которые можно использовать для различных поверхностей, как указано ниже:

ПРАЙМЕР ДЛЯ ПЛАСТИКА Montana T2000:

Для использования на некоторых поверхностях на основе пластика и акрила.Прозрачный цветной спрей. Montana PLASTIC PRIMER — это средство для подготовки поверхности, которое можно использовать для следующих твердых пластмасс: полиуретана (PUR), полистирола (PS), полиамида (PA), модифицированного полипропиленового каучука (EPDM), акриловых бутадиенстирольных пластиков (ABS), стекла- пластмассы, армированные волокном (GfK), твердый поливинилхлорид (Hard-PVC). Всегда пробуйте невидимые участки вашего материала, чтобы проверить совместимость!

ПОЛИСТИРОЛОВАЯ ГРУНТОВКА Montana T2200:

Для большинства поверхностей из полистирола и пенополистирола.Кремовый спрей. Всегда пробуйте невидимые участки вашего материала, чтобы проверить совместимость!

ПРАЙМЕР УНИВЕРСАЛЬНЫЙ Montana T2300:

Для использования на бетоне, кирпиче, терракоте, керамике, коже, картоне, дереве и многих других материалах. Спрей белого цвета.

ПРАЙМЕР МЕТАЛЛ Montana T2400:

Для использования на металлических (железных или латунных) или минеральных поверхностях. Спрей темно-коричневого цвета. Обратите внимание на то, что Metal Primer не подходит для грунтования алюминия.

Как мне начать использовать мой Montana PRIMER?

Снимите распылительную насадку и переверните баллончик вверх дном.Ударьте ладонью, чтобы предохранительное кольцо выпало. Энергично встряхивайте в течение 2–3 минут, убедившись, что вы слышите, как шарики для перемешивания свободно движутся. Установите колпачок обратно на верхнюю часть клапана баллона и поверните спусковой механизм в сторону от субстрата для проверки. Если течет свободно, можно приступать к рисованию.

Какие покрытия можно наносить поверх грунтовки Montana PRIMER?

Вы можете нанести любой цветной, технический или эффектный спрей Montana-Cans на грунтовку Montana PRIMER после того, как они высохнут и затвердеют. Они увеличивают адгезию, помогают герметизировать ваши основания, создают более ровную поверхность и увеличивают долговечность покрытий, нанесенных на нее.

Могу ли я отшлифовать его до желаемого качества поверхности?

Да. Вы можете отшлифовать грунтовку Montana PRIMER, когда она высохнет. В зависимости от сорта наждачной бумаги могут быть получены гладкие или шероховатые поверхности.

Сколько времени нужно Montana Montana PRIMER для высыхания?

Время высыхания зависит от ПРАЙМЕРА и условий его использования. Обычно для высыхания требуется 15-20 минут. Время отверждения может варьироваться в зависимости от основания, температуры окружающей среды, уровня влажности и толщины нанесенного слоя.

Могу ли я использовать другие покрытия на Montana PRIMER, кроме спреев?

Да. После отверждения можно наносить другие покрытия поверх спрея Montana PRIMER. Мы рекомендуем всегда тестировать на невидимых участках работы на совместимость.

ПРАЙМЕР УНИВЕРСАЛЬНЫЙ Montana

Когда следует использовать грунтовку?

Целью грунтования является создание нейтральной поверхности, на которую можно наносить другие покрытия, которые будут иметь максимально возможный срок службы и наиболее эстетичную отделку по желанию.Грунтовки Montana предназначены для предварительной обработки и подготовки поверхностей и обеспечивают максимальную адгезию и защиту при нанесении на них последующих покрытий.

Когда использовать УНИВЕРСАЛЬНЫЙ ПРАЙМЕР Montana?

Montana UNIVERSAL PRIMER — универсальное средство для подготовки поверхностей, которое может использоваться на бетоне, кирпиче, терракоте, керамике, коже, картоне, дереве и многих других материалах. UNIVERSAL PRIMER идеален для тех, у кого мало места, и которым нужен только один универсальный грунт для своих проектов.Мы предлагаем попробовать на невидимой области вашего материала, чтобы проверить совместимость.

Как начать использовать грунтовку Montana UNIVERSAL PRIMER?

Снимите распылительную насадку и переверните баллончик вверх дном. Ударьте ладонью, чтобы предохранительное кольцо выпало. Энергично встряхивайте в течение 2–3 минут, убедившись, что вы слышите, как шарики для перемешивания свободно движутся. Установите колпачок обратно на верхнюю часть клапана баллона и поверните спусковой механизм в сторону от субстрата для проверки. Если течет свободно, можно приступать к рисованию.

Какие покрытия можно наносить поверх UNIVERSAL PRIMER?

Вы можете нанести любой цветной, технический или эффектный спрей Montana-Cans на UNIVERSAL PRIMER после того, как он высохнет.Он увеличит адгезию, поможет герметизировать основу, создать более ровную поверхность и увеличить долговечность нанесенных на нее покрытий.

Могу ли я отшлифовать его до желаемого качества поверхности?

Да. Вы можете отшлифовать грунтовку Montana UNIVERSAL PRIMER после высыхания. В зависимости от сорта наждачной бумаги можно добиться гладких или шероховатых поверхностей.

Сколько времени нужно для высыхания спрея Montana Montana UNIVERSAL PRIMER?

Время высыхания обычно составляет 15-20 минут, но может варьироваться в зависимости от основания, температуры окружающей среды, уровня влажности и толщины нанесенного слоя.

Могу ли я использовать на нем другие покрытия, кроме спрея?

Да. После высыхания можно использовать другие покрытия поверх спрея UNIVERSAL PRIMER. Мы рекомендуем всегда тестировать на невидимых участках работы на совместимость.

Создание универсальных праймеров, нацеленных на неконсервативные, горизонтально подвижные гены: уроки и соображения

Целью этого исследования было пройти рабочий процесс создания праймеров, а затем проверить эффективность разработанных наборов праймеров in silico для оценки успеха или неудачи дизайн.Подход состоит в том, чтобы оценить праймеры перед их экспериментальным использованием, что требует ресурсов и времени на оптимизацию. Результат нашего эксперимента по отжигу праймеров in silico представлен на четырех рисунках, которые иллюстрируют все места связывания для каждого из праймеров в рамках геномов модельного сообщества, разделенных на суперсемейства MDREP (фиг. 1 — фиг. 4). Результаты иллюстрируют прямые попадания в намеченный ген MDREP, но также и непредусмотренные места связывания, где праймеры будут отжигаться при различных температурах отжига и с различной гомологией последовательностей (см. Таблицу 2 для деталей праймеров).На всех рисунках тип используемой линии указывает процент идентичности последовательности (сплошная линия 100%, пунктирная линия от 90,0 до 99,9%, пунктирная линия от 80,0 до 89,9%), а цветовая кодировка используется для обозначения диапазона температур плавления, разделенного на Шаг 5 ° C (светло-зеленый ≤49,9 ° C, оранжевый от 50,0 до 54,9 ° C, синий от 55,0 до 59,9 ° C, фиолетовый от 60,0 до 64,9 ° C, красный от 65,0 до 69,9 ° C и темно-красный ≥70,0 ° C). Для простоты термин «гипотетический белок» относится ко всем генам, аннотированным как кодирующие «консервативный белок с неизвестной функцией», «гипотетический белок», «консервативный гипотетический белок», «консервативный белок с неизвестной функцией» или «консервативный экспортируемый белок с неизвестной функцией». неизвестная функция.

Эта работа иллюстрирует сложность создания универсального набора праймеров для дополнительных / характерных генов по сравнению с основными генами. Далее подчеркивается проблема работы с генами, которые часто встречаются с мобильными генетическими элементами, что дает возможность для увеличения дивергенции. Чтобы проиллюстрировать проблемы, которые мы наблюдали, и наши выводы, мы обсудим несколько ключевых примеров, выделяющих определенные тенденции и трудности, которые были обнаружены в результате этой работы по разработке учебников.

Нецелевое непреднамеренное связывание праймера.

Для начала мы обсудим пример, показывающий потенциал праймера, разработанного для одной мишени, для идентификации других MDREP у другого вида. Вышестоящий праймер norM , нацеленный на Thauera aromatica, имеет относительно высокую температуру отжига целевой последовательности (65,6 ° C) из-за высокого содержания GC, составляющего 75%. Этот праймер имеет пять непреднамеренных целей связывания, все с процентной идентичностью от 90,0 до 99,9% (рис. 1). Два из этих сайтов расположены внутри T. aromatica и являются мишенью dctM (Tmz1t_0544) и yfdV (Tmz1t_0790). dctM кодирует трехкомпонентный АТФ-независимый периплазматический переносчик, который подпадает под классификацию системы транспорта C 4 -дикарбоксилата согласно KEGG, в то время как yfdV кодирует переносчик оттока ауксина, который является только гипотетическим белком с предсказанной общей функцией и, следовательно, может быть более универсальным перевозчиком. Другие непреднамеренные мишени включают гены, кодирующие консервативный мембранный белок с неизвестной функцией у Pseudomonas putida (PP_2935), который временно находится в суперсемействе MFS, большую субъединицу этаноламин-аммиаклиазы (DvMF_1253) и NAD-синтазу (GSUB_13065).Температуры отжига в этих местах находятся на уровне или чуть ниже предполагаемой температуры отжига. Это иллюстрирует наглядный пример праймера, нацеленного на последовательность нуклеотидов, которая может быть консервативной областью определенных генов-переносчиков. Важно отметить, что хотя эти праймеры обнаруживают эти непреднамеренные цели in silico , в каждом случае связывается только один праймер, и поэтому двухцепочечный продукт ПЦР не может образовываться in vitro . На практике эти непреднамеренные взаимодействия отдельных праймеров будут влиять только на амплификацию ПЦР за счет уменьшения доступности праймеров (т.е.е., эффективность праймера) для нахождения намеченной последовательности. Значительные количества взаимодействий связывания вне мишени уменьшат доступность праймеров для связывания с намеченной последовательностью-мишенью, что снижает количество продукции ампликона ПЦР. Это снижение доступности праймера имеет дополнительные последствия для интерпретации данных КПЦР, так как это может привести к недооценке копий гена. Эта проблема также может быть решена в лабораторных условиях с помощью итеративного процесса скрининга для определения идеального диапазона концентраций праймера для каждого праймера с учетом непреднамеренного связывания.Однако использование такого подхода здесь должно сократить такие трудозатраты. Следует учитывать, что это соотношение может варьироваться в зависимости от используемой геномной матрицы, например, чистой культуральной ДНК по сравнению со сложной средой. Более сложным примером праймера с непреднамеренными связывающими взаимодействиями является нижележащий праймер qacA для Desulfovibrio vulgaris ( Рис.2). В этом примере праймер qacA , расположенный ниже по потоку, имеет температуру отжига 55,4 ° C и три непредусмотренных сайта связывания, ни один из которых не находится в области D.vulgaris геном. Праймер связывается при той же или более низкой температуре отжига с pcrA (QU35_03810), кодирующим АТФ-зависимую ДНК-геликазу, и геном альфа-субъединицы сукцинил-КоА-синтетазы (QU35_08905) как в Bacillus subtilis, так и в к гену купина (GSUB_03070) в Geoalkalibacter subterraneus . Этот пример иллюстрирует нежелательное нацеливание, которое не предоставляет никакой дополнительной информации, такой как потенциально консервативные последовательности (домены) оттоковых насосов или идентификация неаннотированных / неправильно аннотированных генов схожей функции.Неясно, какие признаки этих генов способствуют нацеливанию этого праймера. Чтобы проиллюстрировать нежелательное непреднамеренное связывание праймера, мы обсуждаем праймеры, нацеленные на гены суперсемейства SMR (рис. 3). Это суперсемейство представлено генами из P. putida, G. subterraneus , Acetobacterium woodii и B. subtilis, всего восемь различных генов-мишеней. Из этих восьми мишеней праймеры для B. subtilis qacE1 (QU35_18255) и ebrA (QU35_09520) не имеют непредусмотренных мест связывания.Каждый из вышестоящих праймеров для B. subtilis emrE (QU35_06845) и P. putida emrE (PP_4930) имеет одно непреднамеренное место связывания с идентичностью от 90,0 до 99,9%, нацеленное на некодирующую область в G. subterraneus (GSUB: 834814) и ген betA у P. putida (PP_3383) соответственно. Шесть из оставшихся праймеров имеют непреднамеренные мишени с идентичностью от 80,0 до 89,9%, нацеленные на 24 различных гена, кодирующих белки в диапазоне от гипотетических белков (QU35_15730, Tmz1t_0375 и Tmz1t_0977) до переносчиков пермеаз (QU35_06380, QU35_21320 и QU35_1811547), предполагаемого симпортера ), полимеразы (Awo_c25450 и Tmz1t_3813), изомеразы (DvMF_3022 и QU35_19985), а также регуляторы и стрессовые белки (QU35_03275, DvMF_0255, PP_1269 и PP_3526).Более низкий процент совпадений идентичности (от 80,0 до 89,9%) не нацелен на гены с предсказуемой или специфической функцией, а, скорее, цели имеют небольшое сходство, несмотря на обнаружение некоторых связанных с мембраной белков. Обнаруженные гены непреднамеренного оттока принадлежат не к тому же суперсемейству, что и предполагаемые мишени, а скорее относятся к суперсемейству ABC. Интересно, что праймеры, разработанные в рамках этой работы для нацеливания на суперсемейство ABC, для которого существует только одна мишень ( lmrA из B. subtilis; QU35_01610), не имеют непредусмотренных мест связывания.Наконец, мы обсуждаем непреднамеренное нацеливание трех разных праймеров, два из которых были сконструированы с вырожденными основаниями и предназначались для нацеливания на несколько последовательностей у разных видов. Два вырожденных праймера представляют собой восходящий праймер acrB / mexD , нацеленный на оба гена в P. putida, и нижний праймер, нацеленный на acrB в T. aromatica и mexD в P. putida. Единственный целевой праймер представляет собой нижележащий acrB для P. putida, который дополняет праймер P. putida acrB / mexD .Для намеченных мишеней все праймеры отжигаются со 100% идентичностью. Из-за вырожденной природы двух из этих праймеров наблюдается значительное увеличение непреднамеренных целей связывания по сравнению с другими наборами праймеров (фиг. 4). Следует отметить сложность этого рисунка, который был намеренно сохранен, чтобы выделить проблемы непреднамеренных мест связывания праймеров по мере усложнения генных мишеней. Интересно, что непреднамеренные места связывания расположенного выше праймера acrB / mexD находятся исключительно между 90.0 и 99,9% идентичности последовательности, тогда как праймер P. putida ниже acrB имеет сочетание сайтов связывания с высоким процентом идентичности и низким процентом идентичности. Некоторыми из повторяющихся непреднамеренных мишеней являются другие гены mex , в частности mexB и mexF , оба из которых обнаруживаются восходящими и нижележащими праймерами acrB / mexD с идентичностями от 90,0 до 99,9% (за исключением из mexB , который непреднамеренно на 100% идентичен T.aromatica / P. putida mexD нижестоящий праймер). T. aromatica / P. Нижестоящий праймер putida mexD также имеет 100% идентичность с mexF (PP_3426) и геном, кодирующим предполагаемый переносчик RND (PP_0906) (фиг. 4). Многие из непреднамеренных мишеней этого вырожденного нижестоящего праймера представляют собой гены, кодирующие гипотетические белки, и все они имеют температуры отжига от 50,0 до 59,9 ° C (минимум на 5 ° C ниже температуры плавления намеченной мишени). Из непреднамеренных целей вышестоящего P.putida acrB / mexD , два — гены гидрофобного / амфифильного оттока-1 (HAE1) (DvMF_0036 и Tmz1t_0505), один кодирует нехарактеризованный переносчик RND в G. subterraneus (GSUB_042) конечная цель tgB_042 (GSUB_042). (PP_1385) у P. putida, который кодирует вероятный белок-переносчик мембранного оттока. нацеливать и определять местонахождение других подобных генов как в намеченных видах-мишенях, так и в других, неродственных видах, частично благодаря присутствующим вырожденным основаниям.Большинство совпадений локализовано в пределах двух предполагаемых видов, и только два совпадения происходят снаружи: гены, кодирующие HAE1 в D. vulgaris и транспортер RND в G. subterraneus . Важно отметить, что праймеры RND являются единственными праймерами, которые имеют как восходящие, так и нисходящие праймеры, связывающиеся одновременно с одной и той же мишенью, что может приводить к непредусмотренным ампликонам ПЦР. Это происходит в четырех разных генах: mexF (PP_3426), ttgB (PP_1385), HAE1 (Tmz1t_0505) и mexB (PP_3456) (рис.4). Пятый ген (кодирующий предполагаемый переносчик RND, PP_0906) является мишенью множества праймеров; однако этот ген нацелен только на расположенные ниже праймеры, которые связываются с идентичным местом и, таким образом, не могут продуцировать ампликон для ПЦР. Возможно, неудивительно, что праймеры, нацеленные на mexD у P. putida, также связываются и будут производить ПЦР-ампликон на mexB (PP_3456) и mexF (PP_3426), что позволяет предположить, что эти гены имеют гомологичный домен, который влияет на MSA гены mexD .Две другие непреднамеренные мишени с множественными присоединениями праймеров нацелены на ген ttgB (PP_1385) у P. putida, который кодирует вероятный оттокный насос, и на ген HAE1 у T. aromatica (Tmz1t_0505), кодирующий белок, принадлежащий к акрифлавину. семья резистентных белков B (оттокный насос) согласно KEGG. Из этого примера становится ясно, что вырожденные основания позволяют увеличить количество непредусмотренных целевых участков и, в отличие от других примеров, эти праймеры будут производить фактические ампликоны ПЦР, нарушая любые потенциальные количественные ПЦР или последующие анализы.Хотя эти непреднамеренные ампликоны могут быть учтены и удалены с помощью биоинформатики во время секвенирования, в приложениях кПЦР эти продукты, особенно если они имеют такой же размер, что и предполагаемый продукт (или, более конкретно, производят ампликоны с аналогичными точками плавления), могут давать ложноположительные результаты без возможность различать предназначенные и нежелательные продукты. Хотя здесь основное внимание уделялось разработке праймеров для ПЦР для определения присутствия и численности целевых генов в сообществе, праймеры можно было использовать в параллельном рабочем процессе для секвенирования.Чтобы решить проблему, возникающую в результате нашего подхода к дизайну праймеров A (т. Е. Конструированию с использованием вырожденных оснований), мы разработали альтернативный метод (дизайн праймеров B) для создания наборов праймеров, которые предпочтительно нацелены на разные местоположения (т. Е. Потенциально необслуживаемые местоположения), но уделяют приоритетное внимание поддержанию идентичных размеры ампликонов для всех намеченных целей. Как проиллюстрировано с праймерами RND, конструкция A может приводить к увеличению количества непреднамеренных участков связывания из-за экспоненциального увеличения последовательностей праймеров.Каждое вырожденное основание увеличивает количество уникальных последовательностей, присутствующих в смеси праймеров, и может создавать праймер, который не имеет предполагаемой целевой последовательности, что означает увеличение вероятности непреднамеренного связывания. Для иллюстрации возьмем пример, приведенный в таблице 3, для вышестоящего праймера, нацеленного на гены acrB и mexD в P. putida.

ТАБЛИЦА 3

ТАБЛИЦА 3 Пример сравнения предполагаемой и непредусмотренной последовательностей при использовании вырожденных оснований

75

Тип праймера Последовательность a
Желаемая последовательность A TGG CGG ACG AAA GC
Желаемая последовательность B TGG TGG CGC TGT ACG AAA GC
Полученный вырожденный праймер TGG Y GG CGC W GT ACG AAA GC
Все комбинации C GG CGC A GT ACG AAA GC
TGG C GG CGC T GT ACG AAA GC
TGG T GG A GG CGC 907
TGG T GG CGC T GT ACG AAA GC

a

Вырожденная ( жирным шрифтом) базовые коды: Y = C, T; W = А, Т; R = А, G; S = G, C; М = А, С.

Из этого простого примера с использованием двух вырожденных оснований, кодирующих только два нуклеотида каждое, полученный вырожденный праймер состоит из смеси четырех праймеров, два из которых не кодируют какую-либо предполагаемую последовательность. Скорее, более точный подход состоит в том, чтобы рассматривать каждый ген как свою собственную матрицу, конструировать праймеры для создания ампликонов одинакового размера и иметь сходные температуры плавления, а затем объединять все вышестоящие праймеры в единую смесь в равных пропорциях. Таким образом, количество праймеров сводится к минимуму, и каждый праймер имеет желаемую мишень.Альтернативой вырожденным основаниям является использование инозина; однако это не всегда улучшает функцию праймера (42). Основываясь на этом предыдущем исследовании, использование вырожденных оснований улучшает детекцию целевого гена в широком диапазоне, но праймеры страдают от неспецифической амплификации, димеризации и проскальзывания праймеров. Использование инозина вместо вырожденных оснований иногда улучшало обнаружение праймеров, но не всегда для всех их наборов праймеров (42). Правильное использование вырожденных оснований или инозина необходимо оценивать в индивидуальном порядке.

Непредвиденная специфичность этих праймеров является заметной, если учесть, что все праймеры имеют длину от 18 до 23 нуклеотидов и, следовательно, нацелены на последовательность из шести или семи аминокислот. Следует понимать, что не все гены MDREP могут быть обнаружены с использованием этого подхода, но он может предоставить средства для улучшения нашего понимания консервативных областей, и, как показывает эта работа, консервативная аминокислотная область может иметь длину всего шесть или семь аминокислот. кислоты и по-прежнему обеспечивают относительно высокую точность идентификации генов.Из этого ясно, что даже последовательность из шести аминокислот может иметь эволюционное давление, чтобы передать сходство в общей структуре и / или функции белка.

Использование подхода B (т.е. смешивание каждого уникального праймера вместе без вырожденных оснований) позволяет «универсальной» смеси праймеров всегда находиться в движении и улучшаться по мере добавления новых праймеров, до тех пор, пока количество присутствующих праймеров не будет отрицательно влиять на способность специфического праймера связывать правильную последовательность. В отношении подхода B следует учитывать, что, поскольку праймеры не всегда нацелены на консервативные области, праймеры могут иметь непреднамеренные мишени в другом месте генома (генов), совершенно не связанные с целевой последовательностью.В результате, и в соответствии с надлежащей практикой, последовательности праймеров, разработанные с использованием любого из подходов, должны быть протестированы против целевого генома (геномов), и все непредусмотренные места связывания должны быть идентифицированы и учтены в ходе разработки протокола ПЦР.

праймеров MDREP по сравнению с универсальными праймерами 16S рРНК.

В отличие от успешных универсальных дизайнов праймеров, нацеленных на ген 16S рРНК, обсуждаемые здесь вопросы подчеркивают разницу между нацеленными коровыми генами (важными для репликации), генами характеров (определяющими тип метаболизма) и вспомогательными генами (генами, которые может улучшить физическую форму при определенных условиях).По мере того, как мы совершенствуем методы и применяем генетический скрининг к все большему количеству проблем со здоровьем (например, инфекции, болезни и т. Д.) И экономически значимых (например, сельское хозяйство, биоремедиация и т. Д.), Мы будем обнаруживать более актуальные генетические цели. По логике вещей, чем более конкретна цель, тем более значимыми становятся присутствие / отсутствие и количество, но тем дальше от основных генов (переходя к характерным и вспомогательным генам) мы должны двигаться. Дополнительные гены (и, в меньшей степени, характеристические гены) имеют меньшее эволюционное давление на них, что обеспечивает более высокие скорости мутаций и изменчивости на уровне нуклеотидов.Кроме того, поскольку многие вспомогательные гены находятся или могут быть расположены на мобильных генетических элементах, они становятся предметом нуклеотидных смещений и использования кодонов, присутствующих в их текущем хозяине. В то время как консервативные гены могут иметь вариабельные области, фланкированные консервативными областями (например, гены 16S рРНК), которые могут быть нацелены для облегчения конструирования праймеров, неконсервативные гены могут ненадежно иметь консервативные области, вынуждая праймеры нацеливаться на менее консервативные области, более чувствительные к мутациям и вариациям. . Кроме того, механизм движения может влиять на доступность гена или уровни экспрессии.Пригодность вспомогательного гена зависит от давления окружающей среды и подвержена импульсным нагрузкам, таким как короткие периоды воздействия биоцида, что типично для лечения антимикробными препаратами или курсов антибиотиков.

Для сравнения, процент идентичности генов-мишеней был рассчитан с использованием множественного выравнивания последовательностей (MSA) для каждого соответствующего гена. Баллы рассчитывались с использованием уравнения

Процент идентичности = (совпадений × 100) / длина MSA (включая пробелы)

(1)

Каждый MSA был рассчитан с использованием условий, описанных в разделе «Материалы и методы».Только один репрезентативный ген для каждого суперсемейства был выбран как показатель изменчивости внутри этого суперсемейства. Средние оценки идентичности последовательностей перечислены в таблице 4, а полный список оценок каждого гена представлен в таблицах S2-S6 в дополнительном материале. Суперсемейство ABC было опущено из-за низкого количества генов у шести репрезентативных видов.

ТАБЛИЦА 4

ТАБЛИЦА 4 Средние баллы процентной идентичности для генов, выбранных для представления четырех суперсемейств a
Суперсемейство Ген Длина MSA (п.н.) Количество генов Оценка идентичности
16S рРНК 1,595 32 84.71 4,32
MFS qacA / emrB 1,630 6 58,13 6,15
SMR emrE 1,137 3 1,137 3
MATE norM 1,521 3 67,63 1,11
RND acrB 3,990 11 [9] 43.99 [52,71] 19,21 [5,71]

a

MSA, множественное выравнивание последовательностей; SD, стандартное отклонение. В скобках указаны измененные значения, полученные после удаления двух значительно более коротких аннотаций.

Из оценок процента идентичности очевидно, что ген 16S рРНК более консервативен, чем любой из генов эффлюксной помпы. Наивысшая оценка принадлежит гену norM , который среди аннотированных копий имел очень высокий процент идентичности (67.63%), тогда как acrB и emrE имели низкие оценки (43,99 и 49,99% соответственно). Оценка acrB отклонена от двух аннотированных копий, поскольку она значительно короче, чем MSA, что дает процентные оценки идентичности 5,26% и 4,24%. Удаление этих двух копий дало результат 52,71% ± 5,71%, что приближает оценку acrB к результатам qacA / emrB и emrE .

Эти оценки отражают относительную простоту конструирования праймеров для высококонсервативных основных генов, в то время как несущественные дополнительные гены значительно труднее из-за их более пластичной природы.Хотя они менее гомологичны, оценки идентичности позволяют предположить, что для этих периферических генов можно создать универсальные праймеры. Однако эти гены требуют другого подхода к дизайну праймеров. Используя подход A, который использует множественное выравнивание последовательностей, можно идентифицировать более консервативные области для нацеливания, тогда как подход B, который использует уникальные последовательности праймеров (избегая использования вырожденных оснований), приводит к смеси праймеров с более высокой точностью и специфичностью. Там, где подход A может иметь более высокую универсальность для обнаруженных генов, использование вырожденных оснований требует более глубокого исследования непреднамеренных попаданий.Напротив, подход B обеспечит более конкретные, целевые результаты с большей достоверностью, но создание универсальных смесей с помощью смеси целевых праймеров обнаруживает менее разнообразные цели.

Пластичность нуклеотидных последовательностей дополнительных генов является результатом улучшенных преимуществ приспособленности, возникающих только в определенных условиях, которые не всегда присутствуют. Это позволяет возникать мутациям, которые в противном случае были бы невозможны в основных генах или генах признаков. Из-за неконсервативной природы генов MDREP и их мобильности в геномах и между геномами их численность и дисперсия на генетическом уровне непостоянны и непредсказуемы.Наличие одного и того же гена у двух разных видов не позволяет определить направление потока или происхождение гена. Подход in silico , описанный здесь, потенциально может быть использован для исследования эволюционного ветвления в этих генах, а в случае генов MDREP, потенциально проливая свет на то, как эти гены отбираются, и позволяет идентифицировать другие клинически значимые оттокные насосы. еще предстоит открыть.

Как и в случае с примером 16S рРНК, успешные наборы праймеров можно использовать для секвенирования межгенных последовательностей.Степень, в которой это секвенирование позволит более точно аннотировать гены или филогенетическое назначение, будет зависеть от глубины секвенирования данного гена-мишени. Затем праймеры становятся полезными для других родственных методов влажной лаборатории, таких как ПЦР с обратной транскриптазой (ОТ-ПЦР) или FISH.

Соображения и ограничения.

Несмотря на то, что этот подход направлен на сокращение объема устранения неполадок в лабораторных условиях за счет предупреждения ловушек, таких как потеря эффективности праймера из-за связывания со смещением цели, всегда будет требоваться определенная степень устранения неполадок в лабораторных условиях.Эта работа не предназначена для замены или устранения «мокрой лаборатории», а скорее для улучшения дизайна праймеров и уменьшения хорошо известной проблемы зависимости от баз данных аннотаций (43). Важно помнить о конкретной конечной цели праймеров (например, количественная ПЦР, секвенирование ампликона, идентификация ключевого патогена или метаболического потенциала) и то, как это повлияет на параметры дизайна праймера. Даже при нацеливании на один и тот же ген для достижения другой конечной цели могут потребоваться отдельные праймеры.

Здесь первоначальная валидация in vitro некоторых из более сложных праймеров, использующих вырожденные основания, была проведена против P.putida и T. aromatica чистые культуры ДНК и ДНК, собранные из полевых проб образцов пресной поверхностной воды с различными биоцидами (необработанные, бронопол, глутаральдегид, DBNPA и соединения четвертичного аммония). Продукты ПЦР разделяли с использованием 1,5% агарозных гелей при 100 В в течение 45 мин (рис. S.1 — рис. S.4 в дополнительном материале). Выбранные наборы праймеров представляли собой 16S рРНК для валидации полевого шаблона (размер ампликона: 292) (рис. S.1), qacA из P. putida ( P.puti qacA1 / 3_U и P.puti qacA1_D; размер ампликона: 198) (рис. S.2), mexD из P. putida ( P.puti acrB / mexD_U и T.aro acrB2 / P.puti mexD_D; размер ампликона: 187), acrB2 из T. aromatica ( T.aro acrB2_U и T.aro acrB2 / P.puti mexD_D; размер ампликона: 187) (рис. S.3) и acrB из P. putida ( P.puti acrB / mexD_U и P.puti acrB_D; размер ампликона: 187) (рис.S.4). Эти гели показывают, что полевая ДНК, независимо от обработки биоцидом, подходит для ПЦР, поскольку все праймеры 16S рРНК оказались успешными (рис. S.1), но qacA не был обнаружен в этих образцах (рис. S.2). Праймеры qacA1 содержат два непреднамеренных продукта против T. aromatica (∼400 и ∼750 п.н.), но единственный предполагаемый продукт против P. putida. Наборы праймеров, нацеленные на mexD и acrB2 (рис. S.3), имеют идентичные продукты ампликона при использовании против P.putida и T. aromatica, предполагая, что эти праймеры, которые используют вырожденные основания и разделяют следующий праймер ( T.aro acrB2 / P.puti mexD_D), неспособны различить две намеченные мишени при данной температуре отжига. (58 ° С). Набор праймеров, нацеленный на acrB из P. putida, иллюстрирует, как условия цикла ПЦР все еще должны быть правильно настроены, поскольку при температуре отжига 63 ° C против P. putida и T. остается только один продукт.aromatica (рис. S.4, дорожка 5), но много непреднамеренных продуктов против P. putida при температуре отжига 58 ° C (рис. S.4, дорожка 13). Все эти гели указывают на то, что ни один из образцов не содержит P. putida или T. aromatica или каких-либо целевых последовательностей с достаточно высоким сходством, чтобы их можно было обнаружить с помощью этих наборов праймеров. По матрицам ДНК чистой культуры видно, что праймеры работают должным образом (при использовании с соответствующими температурами отжига), но не смогли обнаружить эти цели в полевых образцах.Для дальнейшей проверки этих праймеров были выполнены ПЦР-анализы на образцах с полевыми образцами ДНК с добавлением 1% общей концентрации ДНК геномной ДНК P. putida и T. aromatica (рис. S.5 и S.6). Когда образцы были дополнены геномной ДНК чистых культур, ожидаемые полосы были получены для каждого образца (за исключением NTC), показывая, что эти праймеры все еще могут функционировать в этих полевых образцах, обнаруживая последовательности, добавленные на 1 % от общей концентрации ДНК.

Извлеченные уроки.

Основной проблемой, связанной с попытками создания праймеров, подобными этой, является зачастую низкое качество аннотации наших библиотек геномных данных, особенно для экологических (или, в более общем плане, любых неклинических) видов. Обилие предполагаемых, предсказанных или гипотетических белков сильно ограничивает возможность точного поиска родственных генов для разработки праймеров для конкретных генов. Чтобы решить эту проблему, праймеры должны быть разработаны с использованием хорошо аннотированного генома, который, вероятно, будет присутствовать в среде, где в конечном итоге будут использоваться праймеры.Таким образом, праймеры могут быть сконструированы с большей достоверностью и, как показано здесь, могут использоваться для зондирования геномов с более низким качеством аннотации и помощи в идентификации там желаемых целей.

Как и во всех научных начинаниях, ученый должен помнить о конечной цели праймеров. Здесь мы попытались создать праймеры для одних и тех же генов в шести разных геномах, чтобы в конечном итоге объединить их в «универсальную» смесь праймеров для желаемой мишени. В этих ситуациях непреднамеренное связывание становится более серьезной проблемой, потому что количество специфического праймера уже уменьшено по сравнению с конечной концентрацией праймера, и любое внешнее связывание может привести к ложноотрицательным результатам во время ПЦР-амплификации.Если цель состоит в том, чтобы исследовать смешанный образец на наличие определенного гена (например, для клинического или экологического скрининга), использование вырожденных праймеров становится рискованным, так как это может привести к ложноположительным или отрицательным результатам (если смесь праймеров слишком комплекс и конкурентное связывание праймеров препятствуют правильному связыванию праймера). В качестве альтернативы, в исследовательской науке, такой как попытка, описанная здесь, вырожденные праймеры могут увеличивать способность праймеров обнаруживать дополнительные гены, не идентифицированные в аннотациях.Существует вероятность того, что многие из выбранных праймером генов, кодирующих гипотетические белки, на самом деле представляют собой эффлюксные насосы той или иной природы, и, таким образом, мы можем добавить дополнительные доказательства к этим предсказанным белкам. Затем потребуется более целенаправленное исследование генов, идентифицированных таким образом, например сравнение аминокислотных последовательностей предсказанных генов с известными белками и определение того, действительно ли они кодируют оттокные насосы.

В отличие от семейства генов 16S рРНК, создание универсальных праймеров для мобильных дополнительных генов особенно сложно.Следует отметить полезность и потенциал анализа in silico праймеров, разработанных для менее консервативных генов, и их потенциал для помощи или облегчения улучшенной аннотации в менее изученных организмах.

Выбор того, какой из двух подходов к конструированию праймеров следует использовать, становится решением, основанным на процентной идентичности или консервативности нуклеотидных последовательностей генов-мишеней. Чтобы облегчить принятие решения, необходимо рассчитать процентные показатели идентичности для всех аннотированных копий желаемого целевого гена.Из примеров гена 16S рРНК и MDREP, показанных здесь, мы предлагаем значение отсечения 75%, где для оценок идентичности выше 75% следует использовать дизайн праймера A (с использованием MSA и вырожденных оснований), в то время как оценки идентичности ниже 75% были бы более эффективными, если бы праймеры были разработаны с использованием дизайна B (уникальные последовательности с переменными местами связывания). Это должно уменьшить количество непредусмотренных мест связывания и в целом повысить эффективность связывания праймеров в приложениях ПЦР и количественной ПЦР.

В заключение, эта работа иллюстрирует преимущества и недостатки двух различных подходов к конструированию праймеров.Во-первых, использование множественных выравниваний последовательностей (MSA) для локализации консервативных областей нуклеиновой кислоты позволяет создавать праймеры с вырожденными основаниями и обеспечивает одинаковый размер ампликона ПЦР. С вырожденными основаниями эти праймеры с большей вероятностью будут иметь непреднамеренное связывание и более низкую эффективность праймера во время термоциклирования. Однако эти праймеры с большей вероятностью обнаружат присутствие желаемого (-ых) гена (-ов) в плохо аннотированных геномах при использовании метода in silico .

Второй подход к конструированию праймеров создает праймеры из отдельных генов без нацеливания на консервативные области MSA, одновременно контролируя температуру плавления и размер ампликона, чтобы гарантировать совместимость всех праймеров, разработанных таким образом.Этот подход допускает более строгие условия термоциклирования и уменьшает количество непредусмотренных мест связывания праймеров (таким образом, повышая уровень обнаружения in vitro ), но этот подход с меньшей вероятностью выявит похожие или идентичные гены в смешанной среде.

В целом, эта работа подчеркивает, насколько чрезвычайно важно оценивать частоту ложных открытий в результате выбранного подхода к разработке праймеров и последующие разветвления в интерпретациях, когда дело доходит до определения цели.

Список универсальных праймеров — Блог SignaGen

ПРАЙМЕРЫ ПОСЛЕДОВАТЕЛЬНОСТИ
3 ’AD 5 ’(AGA TGG TGC ACG ATG CAC AG) 3’
3 AOX1 5 ′ (GCA AAT GGC ATT CTG ACA TCC) 3 ’
5 ’AD 5 ’(TTC GAT GAT GAA GAT ACC CC) 3’
5 AOX1 5 ′ (GAC TGG TTC CAA TTG ACA AGC) 3 ’
BGH Реверс 5 ′ (TAG AAG GCA CAG TCG AGG) 3 ′
BK REVERSE 5 ′ (ACA GGA AAC AGC TAT GAC CTT G) 3 ′
CAT-F 5 ′ (ATC CCA ATG GCA TCG TAA AG) 3 ′
CAT-R 5 ′ (ACA GAC GGC ATG ATG AAC CT) 3 ′
CMV Переднее 5 ′ (CGC AAA TGG GCG GTA GGC GTG) 3 ’
EF-1α Переднее 5 ′ (TCA AGC CTC AGA CAG TGG TTC) 3 ’
GEX 3 ‘ 5 ’(CCG GGA GCT GCA TGT GTC AGA GG) 3’
GEX 3’B 5 ’(CAA GCT GTG ACC GTC TCC) 3’
GEX 5 ‘ 5 ’(GGG CTG GCA AGC CAC GTT TGG TG) 3’
GL Грунтовка 1 5 ′ (TGT ATC TTA TGG TAC TGT AAC TG) 3 ’
GL Праймер 2 5 ′ (CTT TAT GTT TTT GGC GTC TTC CA) 3 ′
КС 5 ’(TCG AGG TCG ACG GTA TC) 3’
M13F (-20) 5 ′ (GTA AAA CGA CGG CCA GT) 3 ′
M13F (-40) 5 ′ (GTT TTC CCA GTC ACG AC) 3 ′
M13R 5 ′ (GGA AAC AGC TAT GAC CAT G) 3 ′
myc-HIS обратный 5 ’(ATG ACC GGT ATG CAT ATT CAG) 3’
pBAD Вперед 5 ‘(ATG CCA TAG CAT TTT TAT CC) 3 ’’
pBAD Реверс 5 ′ (GAT TTA ATC TGT ATC AGG) 3 ’
pET Праймер для первичной обработки 5 ′ (ATG CGT CCG GCG TAG A) 3 ’
pFastBacForward 5 ′ (GGA TTA TTC ATA CCG TCC CA) 3 ’
pFastBac Reverse 5 ′ (CAA ATG TGG TAT GGC TGA TT) 3 ’
PREP Вперед 5 ‘(GCT CGA TAC AAT AAA CGC C) 3 ’
pRSET задний 5 ’(TAG TTA TTG CTC AGC GGT GG) 3’
pTrcHis передний 5 ′ (GAG GTA TAT ATT AAT GTA TCG) 3 ’
pTrcHis обратный 5 ′ (GAT TTA ATC TGT ATC AGG) 3 ’
pTRE 3 ’ 5 ’(CCA CAC CTC CCC CTG AAC) 3’
pTRE 5 ’ 5 ′ (CGC CTG GAG ACG CCA TCC) 3 ′
QE Промоутер 5 ’(CCG AAA AGT GCC ACC TG) 3’
QE Реверс 5 ′ (GTT CTG AGG TCA TTA CTG G) 3 ′
RV Грунтовка 3 5 ′ (CTA GCA AAA TAG GCT GTC CC) 3 ′
RV Грунтовка 4 5 ′ (GAC GAT AGT CAT GCC CCG CG) 3 ’
СК 5 ’(CTA GGT GAT CAA GAT CTC GC) 3’
СП6 5 ′ (GAT TTA GGT GAC ACT ATA G) 3 ′
Промоутер SP6 5 ′ (TAT TTA GGT GAC ACT ATA G) 3 ′
T3 5 ′ (AAT TAA CCC TCA CTA AAG GG) 3 ′
T7 5 ′ (TAA TAC GAC TCA CTA TAG GG) 3 ′
T7 задний 5 ′ (TAG TTA TTG CTC AGC GGT GG) 3 ′
T7 Срок 5 ′ (GCT AGT TAT TGC TCA GCG G) 3 ′
U19 5 (GTT TTC CCA GTC ACG ACG T) 3
21TA 5 ′ (TTT TTT TTT TTT TTT TTT TTT A) 3 ′
21TC 5 ′ (TTT TTT TTT TTT TTT TTT TTT C) 3 ′
21TG 5 ′ (TTT TTT TTT TTT TTT TTT TTT G) 3 ′
1012F 5 ′ (GCT GAC AGA CTA ACA GAC) 3 ′
1012R 5 ′ (GCA AAC AAC AGA TGG CTG GC) 3 ′
XL39 5 ′ (ATT AGG ACA AGG CTG GTG GG) 3 ′
V1.5 5 ′ (GGA CTT TCC AAA ATG TCG) 3 ′
3 ’ДНК-BD 5 ′ (TAA GAG TCA CTT TAA AAT TTG TAT) 3 ′
pTRE2-3 ′ 5 ′ (CAT TCT AAA CAA CAC CCT G) 3 ′
T7EEV 5 (AAG GCT AGA GTA CTT AAT ACG A) 3
ACYCDuetUP1 5 ′ (GGA TCT CGA CGC TCT CCC T) 3 ′
DuetDOWN1 5 ′ (GAT TAT GCG GCC GTG TAC AA) 3 ′
DuetUP2 5 ′ (TTG TAC ACG GCC GCA TAA TC) 3 ′
EGFP- C 5 ′ (CAT GGT CCT GCT GGA GTT CGT G) 3 ′
EGFP-N 5 ′ (CGT CGC CGT CCA GCT CGA CCA G) 3 ′
ЛКО1-5 5 ′ (GACTATCATATGCTTACCGT) 3 ′
pGEX 3 5 ′ (GAGCTGCATGTGTCAGAGG) 3 ′
pGEX 5 5 ′ (GGCAAGCCACGTTTGGTG) 3 ′
м Cherry-F 5 ′ (CCCCGTAATGCAGAAGAAGA) 3 ′
м Cherry-R 5 ′ (TTGGTCACCTTCAGCTTGG) 3 ′
pCMV вперед 5 ′ (GAGCTCGTTTAGTGAACCGTC) 3 ′

Новая пара универсальных праймеров для прокариот с улучшенными характеристиками для сообществ, содержащих анаммокс

Оценка микробного сообщества на заводе по очистке сточных вод

Для проведения глубокого таксономического исследования микробных сообществ, связанных с очисткой сточных вод, мы первоначально исследовали База данных EBI MGnify 11 , собирающая профили численности, полученные в результате обследований сообществ, занимающихся очисткой сточных вод на основе ампликона 16S.

Нам удалось приблизительно идентифицировать 1465 родов прокариот в 3433 образцах из 49 исследований (см. Дополнительные данные S1.1), с представителями царства архей примерно в 22,5% образцов. Когда мы ограничили анализ ила, количество исследований было сокращено до 33 с 1363 образцами, однако мы идентифицировали 1379 родов, а количество образцов, показывающих археи, составило около 40% (см. Дополнительные данные S1.2). Такое наблюдение подчеркнуло важность архей в среде сточных вод. Интересно, что в биоме сточных вод мы обнаружили 128 проб (около 3.7%) из 24 исследований (около 50%), показывающих доказательства существования анаммоксов, процент, который вырос примерно до 5% в образцах ила из 10 исследований (30%). Этот результат свидетельствует о необходимости должного учета сообществ анаммокс при оценке профилей численности микробов в таких средах.

Оценка существующих праймеров

Затем мы попытались проверить, способны ли существующие пары праймеров с установленными высокими характеристиками и хорошим охватом для самого широкого диапазона видов микробов надлежащим образом покрыть сообщества, связанные со сточными водами, особенно для компонентов анаммокса, с использованием наиболее обновленных Коллекция 16S RDP.

Все Takahashi et al. 10 и Albertsen et al. 11 пар праймеров были протестированы in silico с использованием RDP ProbeMatch против обновленных последовательностей 16S рРНК всех родов, доступных в текущей базе данных RDP. Как показано на рис. 1, мы обнаружили, что все Albertsen et al. Пары праймеров, нацеленные только на область 16S V1-V3 и V3-V4 и V4, показали хорошие характеристики для бактерий, но имели относительно низкие показатели для видов архей, что, как мы показали выше, актуально для сообществ, связанных со сточными водами 12 .Напротив, пара Takahashi Pro (Pro341F и Pro805R) эффективно показала высокий охват как бактерий, так и архей, несмотря на удивительно низкую эффективность для микробов, очень важных для цикла денитрификации, а именно анаммокс-бактерий, особенно из семейства Brocadiaceae, , Candidatus brocadia. род. Соответственно, наши дальнейшие усилия были сосредоточены на улучшении Takahashi et al. пара праймеров.

Рисунок 1

Сравнение общей теоретической производительности в охвате (процент членов данного ранга сопоставлен) различных пар праймеров, используемых в этом исследовании.

Прогнозируемое улучшение покрытия в базе данных RDP

При специальном сопоставлении с последовательностями Brocadiales мы обнаружили возможность улучшения покрытия пары праймеров Takahashi PRO путем введения дегенерации пурина в прямой праймер Pro341F, так что большинство членов наше сообщество интересов совпало. Чтобы спроектировать это, мы извлекли из глобального набора данных RDP все высококачественные (> 1200 п.н.) 16S, классифицированные как Brocadiaceae по рангу семейства.На этом наборе данных мы смоделировали формирование ампликонов с помощью RDP probeMatch, систематически вызывая дегенерации, которые могли бы приспособиться к членам этого семейства наиболее полным и экономным способом. В итоге мы получили модифицированный праймер Pro341FB, который был соединен с исходным обратным праймером Pro805R и протестирован in silico с использованием подхода с несоответствием 0 и с учетом таксономического охвата в качестве критерия отбора. Как показано на рис. 1, пара праймеров Pro341FB + Pro805R (TAKB_v3v4) оказалась очень скромной 0.Увеличение покрытия на 007% для архей по сравнению с праймером Pro341F + Pro805R (TAK_v3v4), в то время как мы обнаружили заметное увеличение покрытия на 1% для бактерий. Праймер Pro341FB теоретически был способен амплифицировать в общей сложности 59% из примерно 3,2 миллиона последовательностей, имеющихся в банке данных бактерий. В частности, было обнаружено, что праймер Pro341FB нацелен на филы, которые полностью игнорировались праймером Pro341F. Как показано на рис.2, к типам, охват которых увеличился более чем на 25%, относятся Chlamydiae (41%), Lentisphaerae (76%), Omnitrophica (63%), Parcubacteria . (44%), кандидатов подразделения WPS-1 (46%) и, что важно для этого исследования, Planctomycetes (46%).Спускаясь по таксономическому дереву от типа Planctomycetes к родам, участвующим в анаэробном окислении аммония (анаммокс), мы систематически наблюдали увеличение охвата (класс Planctomycetia 45%, порядок Candidatus Brocadiales 28%, семейство Candidatus Brocadiaceae, род Candidatus Brocadia 75%). Как показано на рис. 3, все анаммокс-бактерии (роды Candidatus Brocadia , Candidatus Kuenenia , Candidatus Anammoxoglobus , Candidatus Jettenia и Candidatus Scalindua , которые были почти пропущены первоначальным праймером Procalindua ), которые были почти пропущены первоначальным праймером Procalindua , вторичная ось Y), в результате, как и ожидалось, был значительно более покрыт при использовании праймера Pro341FB.Основные числовые данные о результатах этого сравнения доступны в дополнительных материалах (Дополнительные данные S2).

Рисунок 2

Улучшение таксономического охвата за счет недавно оптимизированного праймера Pro341FB. Значение процента покрытия относится к соотношению между полными последовательностями базы данных RDP, аннотированными с конкретным таксономическим рангом, и теми, которые, как было доказано, генерируют ампликон с использованием оптимизированного в настоящее время праймера Pro341FB и исходного Pro341F (белые полосы) в сочетании с общим обратным праймером Pro805R .Показаны только таксономии с разницей в охвате более 25%. Суффиксы P, C, O, F и G относятся к типу рангов, классу, порядку, семейству и роду соответственно. Черные столбцы отмечают таксономические ранги, связанные с анаммокс-бактериями.

Рисунок 3

Сравнение теоретических характеристик покрытия между новым Pro341FB (черный, левая ось) и исходным Pro341F (красный, правая ось). Семейство Brocadiaceae состоит из 5 родов, 4 из которых представлены на рисунке.Другой род, названный Candidatus jettenia , отсутствует, поскольку в базе данных RDP не было высококачественной последовательности (т.е.> 1200 п.н.).

Тестирование вариаций праймеров с помощью NGS в выбранных сообществах

Чтобы проверить повышение эффективности для сообществ анаммокс с помощью нашего модифицированного прямого праймера Pro341FB, мы собрали образцы микробных сообществ из 5 различных источников, а именно из активированного ила с домашней станции очистки сточных вод ( SCS), активный ил с очистных сооружений кожевенного завода (CDS), аэробный гранулированный ил (AGS) и гранулированный ил частичной нитрификации анаммокс (PNA) из реакторов пилотного масштаба, питаемых бытовыми сточными водами.Для двух первых заводов также были собраны образцы из их реакторов анаэробного сбраживания (SCD и CDD, соответственно). Образцы были собраны из биореакторов, работающих в самых разных условиях (взвешенные по сравнению с биопленкой и аэробные / бескислородные по сравнению с анаэробными), и в них были добавлены различные субстраты, чтобы обеспечить валидацию протокола в большинстве селективных условий, типичных для микробных сообществ при очистке сточных вод. . Общая ДНК всех сообществ была экстрагирована, и ампликоны были созданы с использованием пар праймеров Pro341F + Pro805R или Pro341FB + Pro805R.Как показано на рис. 4, NGS показал, что процент идентифицированных типов был почти одинаковым во всех образцах, но в PNA, где сообщества анаммоксов были в значительной степени недооценены Pro341F по сравнению с Pro341FB. В качестве подтверждения недавно появилось сообщение о том, что виды анаммоксов в значительной степени доминируют в популяции гранул 1 , что подчеркивает недооценку исходным праймером Pro341F.

Рисунок 4

Проверка NGS улучшения процента покрытия для членов семейства Brocadiaceae оптимизированным праймером Pro341FB.Тестируемые образцы (CDS, CDD, SCS, SCD, AGS, PNA, см. Описание в тексте) были амплифицированы с помощью Pro341F (суффикс 1) или Pro341FB (суффикс 2). Образцы, отмеченные суффиксом 2, систематически занимают более высокое место в ассоциированных рангах Brocadia .

AK02 | Универсальный грунт Tnemec

Series AK02

Универсальный грунт Tnemec

Общий тип

Алкид фенольный

Обычное использование

Не содержащий свинца и хроматов, быстросохнущий, коррозионно-стойкий грунт, подходящий для различных высокоэффективных финишных покрытий.Идеально подходит для сталелитейных заводов, производителей оригинального оборудования и в полевых условиях, где требуются характеристики «сухого падения». Примечание: Не рекомендуется для погружения.

Особая квалификация

Сварные швы, полученные в соответствии с ASW D1.1 — AK02, прошли испытания на целостность сварного шва.

Посмотреть дополнительные сведения о продукте

Время отверждения

Температура: 75 ° F (24 ° C)
На ощупь: 15 минут
До обработки: 30 минут
Высыхание: 45 минут

Для перекрытия (минимум):

| Сама и алкиды || Акриловые и латексные краски на водной основе || Эпоксидные смолы и полиуретаны |

| 16 часов || 24 часа || 24 часа |

HAPS

Необеспеченный: 2.20 фунтов / галлон сухого вещества
Разбавленный на 4% (Растворитель № 2): 2,72 фунта / галлон сухого вещества
Разбавленный на 9% (Разбавитель № 2): 3,36 фунта / галлон сухого вещества

Верхние покрытия

Серия AK02, 2H, 2HS, 43-36, 66, N69, 73, 115, 1026, 1028, 1075, 1095. Примечание: Максимальное время перекрытия для указанных верхних покрытий отсутствует.

Летучие органические соединения

Несобранный: 2,75 фунта / галлон (330 г / литр)
Разбавленный на 4% (No.2): 2,94 фунта / галлон (352 г / л)
Разбавитель на 9% (Разбавитель № 2): 3,15 фунта / галлон (377 г / литр)

Рекомендуемая ТСП

от 2,0 до 3,5 мил (от 50 до 90 микрон) на один слой.

Теоретическое покрытие

898 мил кв. Футов / галлон (22,0 м² / л при 25 микронах). См. ПРИЛОЖЕНИЕ для получения информации о степени покрытия. †

Разработка универсального праймера для прокариот для одновременного анализа бактерий и архей с использованием секвенирования нового поколения

Abstract

Критически важным шагом для анализа структуры микробного сообщества на основе разнообразия последовательностей 16S рДНК является чувствительная и надежная ПЦР-амплификация 16S рДНК.Чтобы получить точные данные о микробном составе, амплификация ПЦР не должна иметь систематической ошибки; однако амплификация всех видов 16S рДНК с одинаковой эффективностью из образца, содержащего большое количество микроорганизмов, остается сложной задачей. Здесь мы разработали универсальный праймер на основе гипервариабельной области V3-V4 прокариотической 16S рДНК для одновременного обнаружения бактерий и Archaea в образцах фекалий гибридных свиней (Landrace × Large white × Duroc) с использованием Illumina MiSeq next -поколение секвенсора.Анализ In-silico показал, что недавно разработанные универсальные прокариотические праймеры соответствовали приблизительно 98,0% последовательностям гена рРНК Bacteria и 94,6% последовательностям гена рРНК Archaea в базе данных Ribosomal Database Project. Для каждой реакции секвенирования, выполненной с универсальным прокариотическим праймером, было получено в среднем 69 330 (± 20 482) прочтений, из которых гены архейной рРНК составляли приблизительно от 1,2% до 3,2% от всех прокариотических прочтений. Кроме того, частота обнаружения бактерий , принадлежащих к типу Verrucomicrobia , включая представителей классов Verrucomicrobiae и Opitutae , была выше в NGS-анализе с использованием прокариотического универсального праймера, чем с бактериальным универсальным праймером. .Важно отметить, что этот новый набор универсальных праймеров для прокариот имел заметно меньшее смещение, чем у большинства ранее разработанных универсальных праймеров. Наши результаты показывают, что набор универсальных праймеров для прокариот, разработанный в настоящем исследовании, позволит одновременно обнаруживать бактерий и архей и, следовательно, позволит более полно понять структуры микробного сообщества в образцах окружающей среды.

Образец цитирования: Такахаши С., Томита Дж., Нисиока К., Хисада Т., Нисидзима М. (2014) Разработка прокариотического универсального праймера для одновременного анализа бактерий и архей с использованием секвенирования следующего поколения.PLoS ONE 9 (8): e105592. https://doi.org/10.1371/journal.pone.0105592

Редактор: Костас Бурцис, Международное агентство по атомной энергии, Австрия

Поступило: 29 апреля 2014 г .; Принято к печати: 26 июля 2014 г .; Опубликовано: 21 августа 2014 г.

Авторские права: © 2014 Takahashi et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Авторы подтверждают, что все данные, лежащие в основе выводов, полностью доступны без ограничений. Все данные, лежащие в основе результатов исследования, доступны либо в рукописи, либо из архива последовательного чтения Японского банка данных (DDBJ) под регистрационным номером DRA002295.

Финансирование: У авторов нет поддержки или финансирования, чтобы сообщить.

Конкурирующие интересы: Все авторы являются оплачиваемыми сотрудниками ООО «Лаборатория ТехноСуруга»., Ltd. (Нагасаки, Япония). Однако такая принадлежность не меняет приверженности авторов политике PLOS ONE в отношении обмена данными и материалами.

Введение

Анализ 16S рРНК (16S рДНК) дает ценную филогенетическую информацию для сравнения микробного разнообразия в образцах окружающей среды. Ряд молекулярно-биологических методов, основанных на разнообразии последовательностей гена 16S рДНК, был разработан для исследования структуры микробного сообщества. Среди этих методов часто используются методы снятия отпечатков пальцев, такие как денатурирующий градиентный гель-электрофорез (DGGE) [1] — [3] и полиморфизм длины концевого рестрикционного фрагмента (T-RFLP) [4] — [6], поскольку они просты в использовании. использования и относительно невысокая стоимость [7].Создание библиотек клонов 16S рДНК также широко используется для изучения структуры микробного сообщества [2], [4], [8]. Однако, поскольку эти независимые от культуры подходы, по оценкам, выявляют только 0,1% ~ 1% от общей микробной популяции, они не являются оптимальными для анализа субдоминантных видов или групп микробов [9], [10].

В последние годы развитие технологий секвенирования следующего поколения (NGS) позволило провести углубленное секвенирование и анализ данных различных типов образцов окружающей среды [11] — [15] на более глубоком уровне, чем это возможно с помощью стандартных молекулярно-биологических методов [ 16].В частности, стратегии на основе Illumina, которые обеспечивают парные считывания одного и того же фрагмента ДНК, предлагают возможность мультиплексирования и генерируют большие объемы данных о последовательностях [16], [17]. Из коммерчески доступных платформ Illumina секвенатор MiSeq имеет наибольший потенциал для исследования последовательности 16S рДНК, поскольку он генерирует считывание последовательностей длиной до 600 п.н. и имеет соотношение производительности и стоимости, приемлемое для исследовательских лабораторий среднего размера [18]. Создание более длинных считываний последовательностей — важная особенность этой платформы, поскольку их легче отнести к таксономическим группам [19].Кроме того, поскольку платформа MiSeq Illumina позволяет проводить более глубокое секвенирование, чем традиционные подходы, она позволяет обнаруживать и анализировать субдоминирующие виды или группы микробов [11]. Следовательно, сочетание этой технологии NGS с надежными наборами универсальных прокариотических праймеров позволит более точно определять соотношение бактерий к архей , чем традиционные подходы. В нескольких исследованиях были успешно применены прокариотические универсальные наборы праймеров и платформы NGS для анализа структуры микробного сообщества в экологических и клинических образцах, включая арктический морской лед, почву и мочевые катетеры [20] — [22].Однако филогенетическая специфичность и степень предвзятости этих прокариотических универсальных праймеров остаются неясными.

В настоящем исследовании мы разработали универсальные наборы праймеров для специфического обнаружения областей V3-V4 прокариотической 16S рДНК, включая домены Bacteria и Archaea . Кроме того, мы разработали систему одновременного анализа для бактерий и архей на основе технологии секвенирования нового поколения Illumina MiSeq.

Материалы и методы

Образцы кала

Пробы фекалий были собраны у трех 11-месячных гибридных свиней (Ландрас × Большой белый × Дюрок), которые содержались на ферме, поддерживаемой префектурным университетом Киото.Разведение свиней проводилось в соответствии с Руководством по уходу и использованию лабораторных животных Комитета по экспериментам на животных Префектурного университета Киото. Поскольку фекалии собирали неинвазивным способом, номер разрешения для исследования не требовался. Д-р К. Ушида и д-р С. Цучида (Университет префектуры Киото) любезно собрали пробы фекалий, а затем перевезли их в нашу лабораторию. Фекалии отдельных свиней были разделены на образцы по 5 г и затем заморожены при -80 ° C до использования.

Экстракция ДНК

Замороженные образцы фекалий размораживали на льду, 100 мг каждого образца суспендировали в 4 М тиоцианате гуанидия, 100 мМ Трис-HCl (pH 9,0) и 40 мМ ЭДТА, а затем образцы взбивали шариками из диоксида циркония с использованием FastPrep FP100A. прибор (MP Biomedicals, США). ДНК экстрагировали из суспензий, обработанных гранулами, с использованием Magtration System 12GC и серии GC MagDEA DNA 200 (Precision System Science, Япония). Концентрации ДНК оценивали спектрофотометрически на приборе ND-1000 (NanDrop Technologies, США), а конечную концентрацию образца ДНК доводили до 10 нг / мкл.

Разработка универсального набора праймеров для прокариот

Ранее опубликованные универсальные наборы праймеров для ПЦР, нацеленные на область V3-V4 бактериальной и архейной рДНК, были модифицированы для увеличения скорости обнаружения прокариот [23], [24]. Множественные выравнивания последовательностей 16S рДНК, полученных из базы данных DDBJ / GenBank / EMBL для выбранных эталонных организмов, проводили с использованием программы Clustal W с настройками по умолчанию [25]. На основании результатов выравнивания последовательности праймеров, которые давали наименьшее количество несовпадений в гипервариабельной области V3-V4 гена 16S рРНК, были выбраны в качестве универсальных прокариотических праймеров.Покрытие предыдущего и настоящего наборов праймеров проверялось по последовательностям хорошего качества (как определено на основе оценок Pintail в базе данных RDP) более 1200 п.н. и ≤1 несовпадений [26] в базе данных RDP (версия 10) с использованием функции Программа Probe Match [27]. Последовательности праймеров и связанные анализы ПЦР, использованные в этом исследовании, перечислены в таблице 1.

Поколение библиотеки Illumina

Область V3-V4 рДНК 16S амплифицировали с использованием Pro341F / Pro805R для прокариот , 341F / R806 для бактерий и ARC344F / Arch806R для наборов праймеров Archaea (таблица 1).В дополнение к специфическим праймерам V3-V4 эти праймеры комплементарны стандартным прямым и обратным праймерам Illumina. Обратный праймер также содержал индексирующую последовательность длиной 6 пар оснований (таблица 1) для обеспечения мультиплексирования. Праймеры для амплификации были разработаны с адаптерами Illumina.

Чтобы уменьшить образование ложных побочных продуктов в процессе амплификации, использовали метод Touchdown PCR для термоциклирования с количественным термоциклером Rotor-Gene Q (Qiagen, Германия) [28].Реакционная смесь (25 мкл) содержала 10 нг геномной ДНК, MightyAmp for Real Time (SYBR Plus) (Takara, Япония) и 0,25 мкМ каждого праймера. Условия реакции ПЦР для амплификации ДНК были следующими: начальная денатурация при 98 ° C в течение 2 минут, затем 35 циклов отжига, начиная с 65 ° C и заканчивая 55 ° C в течение 15 секунд, и удлинение при 68 ° C в течение 30 сек. Температуру отжига снижали на 1 ° C в каждом цикле до достижения 55 ° C, которое использовали для остальных циклов. Продукты ПЦР очищали с помощью фильтровального планшета MultiScreen PCR u96 (Merck Millipore, США) и анализировали с использованием набора Bioanalyzer DNA 1000 Chip Kit (Agilent Technologies, США) для обнаружения димеров праймеров и определения средней молекулярной массы каждого продукта.Очищенные продукты были количественно определены с помощью количественной ПЦР в реальном времени (q-PCR) на количественном термоциклере Rotor-Gene Q с использованием MightyAmp for Real Time (SYBR Plus), 0,2 мкМ каждого праймера, которые были получены из адаптеров Illumina (Таблица 1 ) и серийно разведенную контрольную библиотеку PhiX (Illumina, США) в качестве стандарта. Условия реакции ПЦР для количественного определения каждого продукта ПЦР были следующими: начальная денатурация при 98 ° C в течение 2 минут, затем 30 циклов денатурации при 98 ° C в течение 10 секунд, отжиг при 60 ° C в течение 15 секунд и удлинение при 68 ° C в течение 30 сек.Этап количественной оценки использовался для определения концентрации амплифицированных библиотек и подтверждения наличия подходящих праймеров для секвенирования Illumina.

Секвенирование и качественная фильтрация Illumina

Каждый пул мультиплексированных библиотек был дополнен 25% -ным контролем phiX для улучшения базового вызова во время секвенирования, как рекомендовано Illumina для объединения двух библиотек. Секвенирование проводили с использованием цикла парных концов, 2 × 250 пар оснований, в системе секвенирования Illumina MiSeq и химии MiSeq Reagent Nano Kit версии 2 (500 циклов).После завершения секвенирования были выполнены анализ изображений, базовый вызов и оценка ошибок с использованием программного обеспечения Illumina Real-Time Analysis (версия 1.17.28).

Было выполнено секвенирование парных концов с длиной считывания 251 п.н. После демультиплексирования наблюдалось четкое перекрытие считываний на парных концах. Это позволило объединить парные чтения вместе с программой fastq-join (http://code.google.com/p/ea-utils/). Для дальнейшего анализа были извлечены только те чтения, которые имели оценку значения качества (QV) ≥20 для более чем 99% последовательности.Все последовательности с неоднозначными базовыми вызовами были отброшены. Набор данных нуклеотидных последовательностей был депонирован в Архиве считывания последовательностей Банка данных ДНК Японии (DDBJ) под номером доступа DRA002295.

Таксономический анализ на основе 16S рДНК

Анализы считываний последовательностей были выполнены вручную с помощью инструмента Multiclassifier проекта Ribosomal Database Project (RDP) [19], который доступен на веб-сайте RDP (http://rdp.cme.msu.edu/classifier/). Показания, полученные в формате FASTA, были отнесены к уровням классов с порогом достоверности 80%.

Количественная ПЦР в реальном времени

Количественное определение всех бактерий , архей , класса Thermoplasmata и класса Methanobacteria в кишечном тракте свиней проводили с использованием количественной ПЦР в реальном времени (кПЦР). Для получения стандартов для КПЦР очищенную геномную ДНК из Escherichia coli JCM 1649 T и Methanosarcina acetivorans DSM 2834 T амплифицировали с использованием пар праймеров 8F и 1510R или 21F и 1510R, соответственно (Таблица 1).Выделенную фекальную ДНК амплифицировали с использованием пар праймеров Pig Thermo F и Pig Thermo R или Pig Methano F и Pig Methano R (таблица 1). Реакционная смесь для ПЦР (25 мкл) содержала 20 нг геномной ДНК, 2 × буфер MightyAmp Ver.2 (Takara), 0,25 мкМ каждого праймера и 1,25 единицы ДНК-полимеразы MightyAmp (Takara). Условия цикла были следующими: начальная денатурация при 98 ° C в течение 2 минут, затем 35 циклов при 98 ° C в течение 10 секунд, 55 ° C в течение 15 секунд и 68 ° C в течение 1 минуты. Продукты амплификации (3 мкл) смешивали с 1 мкл красителя ДНК EZ-Vision One (Amresco Inc., USA), а затем разделены электрофорезом на 2% агарозных гелях, чтобы подтвердить получение одного продукта с ожидаемой молекулярной массой. Продукты ПЦР очищали с использованием Econo Spin IIa (Gene Design, Япония), а затем клонировали в вектор pGEM-T Easy (Promega, США) для трансформации компетентных клеток E. coli HST08 Premium (Takara). Положительные трансформанты были отобраны на агаре LB с добавлением ампициллина (100 мкг / мл), и единственная колония, которая была подтверждена с помощью ПЦР на наличие плазмиды с ожидаемой вставкой ДНК, была выращена в 5 мл среды LB с добавлением ампициллина (100 мкг / мл). ) с ночевкой.Культуру центрифугировали при 7610 × g для осаждения клеток, а затем плазмидную ДНК экстрагировали из клеток с использованием набора QIAprep Spin miniprep в соответствии с инструкциями производителя (Qiagen). Очищенную плазмиду количественно оценивали с помощью прибора ND-1000. Число копий 16S рДНК, присутствующих в препарате плазмиды, оценивали на основе концентрации ДНК и молекулярной массы pGEM-T Easy с целевой вставкой, как описано ранее [29]. Для расчета ожидаемый вес в Дальтонах (г / моль) плазмидной конструкции сначала был определен с использованием уравнения: (длина двухцепочечного продукта в парах оснований [bp]) * (330 Da × 2 нуклеотида / bp) .Полученное значение затем делили на число Авогадро (6,022 × 10 23 ), чтобы получить количество граммов на молекулу, которое затем делили на общее количество препарата плазмиды, чтобы получить общее количество копий, присутствующих в образце. Очищенный раствор плазмидной ДНК серийно разводили в 10 раз с получением растворов в диапазоне от 10 3 до 10 7 копий / мкл. Серийно разведенные образцы использовали для построения стандартной кривой, которая использовалась для оценки количества копий целевой группы для каждой реакции qPCR.

Q-PCR

выполняли на количественном термоциклере Rotor-Gene Q с использованием SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara). Каждая реакционная смесь (20 мкл) содержала 20 нг экстрагированной ДНК и 0,2 мкМ каждого праймера. Условия цикла были следующими: начальная денатурация при 95 ° C в течение 30 секунд, затем 35 циклов при 95 ° C в течение 5 секунд, 60 ° C (все Bacteria и Archaea ), 58 ° C ( Thermoplasmata ). ) или 55 ° C ( Methanobacteria ) в течение 20 секунд и 72 ° C в течение 20 секунд.Для каждой реакции вместе с образцами анализировали положительный контроль и отрицательный водный контроль. Кривые плавления амплифицированной ДНК были построены для проверки специфичности реакции. Отношение общей популяции архей к популяции прокариот оценивали по общему количеству копий бактерий и архей, используя следующее уравнение: (1)

, где A — общее количество копий Bacteria , а B — общее количество копий Archaea . Аналогичным образом соотношение Thermoplasmata к Methanobacteria также было рассчитано с использованием уравнения (1), где A представляет общее количество копий Thermoplasmata , а B представляет общее количество копий Methanobacteria .

Результаты

Разработка и покрытие прокариотического универсального праймера

Мы модифицировали универсальные праймеры Pro341F и Pro805R, которые нацелены на гипервариабельную область V3 – V4 16S рДНК как Bacteria , так и Archaea , чтобы улучшить охват существующих последовательностей в базе данных RDP. Результаты анализа in-silico на специфичность праймера против последовательностей 16S рДНК вновь созданного праймера и универсальных праймеров, специфичных для домена Bacteria и Archaea , представлены в таблице 2.Новый прокариотический универсальный праймер соответствовал приблизительно 98,0% последовательностей гена бактерий и 94,6% последовательностей гена рРНК Archaea , присутствующих в базе данных RDP (выпуск 10). Процент совпадения доменно-специфических праймеров Bacteria (341F / R806) и Archaea (ARC344F / Arch806R) в процентах совпадений составлял 97,4% и 63,4% соответственно. Таким образом, охват последовательностей архей вновь созданным прокариотическим универсальным праймером был заметно выше, чем охват специфическим для архей праймером.

NGS-анализ с использованием прокариотического универсального праймера

Чтобы определить, можно ли одновременно обнаружить бактерий и архей с помощью недавно разработанного универсального прокариотического праймера, для образцов фекалий свиней был проведен NGS-анализ. Используя этот праймер и комбинацию платформы MiSeq, для каждой реакции секвенирования было получено в среднем 69 330 (± 20 482) считывания. Затем чтения были проанализированы на уровне класса с помощью инструмента RDP Multiclassifier (рис.1). Анализ NGS показал, что представители класса Clostridia были наиболее доминирующей таксономической группой во всех выборках. Как показано на рис. 1, чтения, соответствующие генам рРНК архей, составляли приблизительно от 1,2% до 3,2% прочтений прокариот для всех образцов, проанализированных с использованием прокариотического универсального праймера.

Рис. 1. Результаты NGS-анализа на уровне класса микробного разнообразия в образцах фекалий свиней с использованием прокариотического универсального праймера.

Столбчатые диаграммы показывают таксономические профили, полученные для каждого из трех образцов фекалий свиней.Острие стрелок указывает на чтение архей ( Methanobacteria ).

https://doi.org/10.1371/journal.pone.0105592.g001

Сравнение соотношения численности прокариот, определенного с помощью NGS и q-PCR

Затем мы проанализировали, влияет ли смещение праймера на скорость обнаружения Archaea , рассчитав относительную численность последовательностей Bacteria по сравнению с последовательностями Archaea с помощью q-PCR. Коэффициент численности архей был приблизительно равен 1.От 1% до 2,6% всех прокариот, а соотношение численности бактерий и архей соответствовало результатам q-ПЦР (рис. 2). На основании этого результата было определено, что прокариотический универсальный праймер не проявлял сильного смещения праймеров и был способен точно отражать относительную численность бактерий и архей .

Рисунок 2. Относительные соотношения численности бактерий и Archaea , оцененные NGS с прокариотическим универсальным праймером.

Результаты NGS-анализа трех образцов фекалий свиней сравниваются с результатами, полученными с помощью количественной ПЦР в реальном времени (кПЦР).

https://doi.org/10.1371/journal.pone.0105592.g002

Смещение ПЦР прокариотического универсального праймера для домена

Бактерии

Чтобы оценить влияние смещения праймеров на оценку численности бактериальных таксономических групп, сравнивали результаты NGS-анализа, полученные с использованием бактериальных и недавно разработанных универсальных праймеров для прокариот.Оценочные соотношения численности таксономических групп бактерий на основе последовательностей, полученных с помощью универсального праймера для прокариот или бактерий, совпадали почти для всех доминирующих таксономических групп бактерий (соотношение численности> 0,001%) (рис. 3). Однако последовательности архей также были обнаружены в анализах, выполненных с помощью бактериального универсального праймера, что указывает на наличие систематической ошибки праймера, хотя частота обнаружения Archaea была снижена по сравнению с частотой, полученной с помощью универсального праймера для прокариот.Кроме того, частота обнаружения бактерий , принадлежащих к типу Verrucomicrobia , включая представителей классов Verrucomicrobiae и Opitutae , была выше в NGS-анализе с использованием прокариотического универсального праймера, чем с бактериальным универсальным праймером. (Рис.4).

Смещение ПЦР прокариотического универсального праймера для домена

Archaea с помощью анализа NGS и q-PCR

Чтобы оценить влияние смещения праймеров на оценку численности двух основных таксономических групп архей (классы Thermoplasmata и Methanobacteria ), обнаруженных в анализе NGS, сравнивали результаты, полученные с использованием универсальных праймеров для архей и прокариот.Частота обнаружения представителей класса Methanobacteria была выше при NGS-анализе с использованием универсального праймера для прокариот, чем при анализе с универсальным праймером для архей (рис. 5).

Наборы праймеров для конкретных классов

для анализа q-PCR были также разработаны для оценки и сравнения относительных соотношений численности классов Thermoplasmata и Methanobacteria с анализом NGS. Соотношения численности этих двух классов в Archaea были сходными для анализа NGS с использованием прокариотического праймера и анализа q-PCR с использованием наборов класс-специфичных праймеров (рис.5), хотя относительная численность Methanobacteria была заметно выше при использовании прокариотического универсального праймера в первых образцах фекалий (рис. 5, свинья 1). Напротив, оценочные отношения численности классов Thermoplasmata и Methanobacteria с помощью q-PCR заметно различались по сравнению с анализом NGS, выполненным с универсальным праймером для архей. В частности, соотношение Methanobacteria в анализе с универсальным праймером для архей было ниже, чем рассчитанное с использованием класс-специфичных праймеров в анализе q-PCR.

Обсуждение

В настоящем исследовании мы разработали и исследовали применимость прокариотического универсального праймера для одновременной амплификации бактериальной и архейной 16S рДНК с использованием секвенатора нового поколения Illumina MiSeq. Мы обнаружили, что недавно разработанный набор праймеров соответствует 98,0% последовательностей бактерий и 94,6% последовательностей гена рРНК архей в базе данных RDP и позволяет одновременно анализировать бактерий и архей в образцах фекалий свиней.Кроме того, прокариотический универсальный праймер имеет меньшую систематическую ошибку, чем ранее описанные универсальные праймеры, и эта характеристика имеет решающее значение для получения точных данных о микробном составе. Таким образом, ожидается, что недавно разработанный универсальный набор праймеров для прокариот позволит одновременно обнаруживать бактерий и архей в образцах окружающей среды и, следовательно, повысит стоимость и эффективность анализа структуры микробного сообщества с использованием технологии NGS.

В NGS-анализах с использованием недавно разработанного универсального праймера для прокариот все идентифицированные таксономические группы также были обнаружены в анализе секвенирования с помощью бактериального универсального праймера; однако частота обнаружения нескольких таксономических групп заметно различалась между двумя наборами праймеров.Примечательно, что бактерии, принадлежащие к классам Verrucomicrobiae и Opitutae , выявлялись в образцах фекалий почти в пять раз чаще с помощью прокариотического универсального праймера. Прокариотический универсальный праймер был разработан на основе универсального праймера (Uni340F, 5′-CCTACGGGRBGCASCAG-3 ‘), описанного Takai и Horikoshi [23]. Однако мы предположили, что представителей Verrucomicrobiae и Opitutae , которые все чаще признаются многочисленными видами в различных средах, было трудно обнаружить с использованием праймера 341F из-за несоответствия одного основания с геном 16S рРНК на 9-м основании от 5′-конец бактериального праймера 341F.Таким образом, мы модифицировали праймер Uni340F для удаления одиночного несоответствия (5′-CCTACGGG N BGCASCAG ‘) и подтвердили, что относительная скорость обнаружения Verrucomicrobiae и Opitutae с модифицированным прокариотическим универсальным праймером увеличилась в пять раз по сравнению с бактериальный универсальный праймер. Несколько исследований также продемонстрировали, что даже одно внутреннее несовпадение нуклеотидов в целевой области V3-V4 праймера может радикально изменить смещение ПЦР [_ENREF_1430-32]. Например, сравнение двух наборов праймеров, нацеленных на область V3-V4 гена 16S рРНК, показало, что были обнаружены совершенно разные фракции бактериального сообщества в активном иле [31], [33].Кроме того, различия в нуклеотидной последовательности праймера и области V3 сильно повлияли на структуру микробного сообщества [14]. Мы также обнаружили, что набор универсальных праймеров для прокариот дает разные соотношения численности для классов Thermoplasmata и Methanobacteria по сравнению с универсальным праймером для архей в NGS-анализе трех образцов фекалий свиней. Результаты q-PCR со специфическими праймерами для этих двух классов позволяют предположить, что универсальный праймер для прокариот более точно оценивает соотношения численности, чем универсальный праймер для архей.Однако для подтверждения этих результатов необходим анализ большего количества образцов окружающей среды с использованием обоих наборов праймеров.

Анализ

NGS с прокариотическим универсальным праймером показал, что представители класса Clostridia были наиболее доминирующей таксономической группой во всех образцах фекалий. Этот вывод согласуется с предыдущим анализом кишечной микрофлоры свиней на основе 16S рДНК, который показал, что Clostridiales были доминирующей бактериальной группой [34] — [36]. Кроме того, мы обнаружили, что гены рРНК архей составляют примерно 1.От 2% до 3,2% всех прокариотических прочтений в анализе с прокариотическим универсальным праймером. Все больше данных свидетельствует о том, что археи широко распространены в окружающей среде [37], [38], и хорошо известно, что археи являются частью кишечной микробиоты человека [38], хотя комплексный анализ структуры сообщества архей еще не проведен. быть исполненным. Однако, насколько нам известно, это первый отчет об относительной численности архей в кишечном тракте свиней с использованием подхода NGS.В нескольких исследованиях изучали микробное разнообразие у свиней с использованием библиотек клонов DGGE и 16S рДНК [36], [39]. Например, относительно недавнее исследование изучало микробный состав аэрозолей в помещении для свиней и обнаружило, что все обнаруженные последовательности архей принадлежали метаногенным архее, что согласуется с нашими нынешними находками обильных метанобактерий 16S рРНК в образцах фекалий свиней. [39].

Для точного определения структуры микробного сообщества на основе разнообразия последовательностей 16S рДНК критически важна чувствительная, надежная и объективная ПЦР-амплификация 16S рДНК.В частности, высокий процент совпадения праймеров имеет решающее значение для избежания систематической ошибки при независимых от культивирования исследованиях структуры микробного сообщества. Настоящий анализ in-silico показал, что степень покрытия недавно разработанного универсального прокариотического праймера для последовательностей в базе данных RDP была примерно на 0,5% выше для Bacteria и на 0,8% выше для Archaea , чем у ранее описанных универсальных праймеров. [23], [40]. Мы также продемонстрировали, что разработанный здесь универсальный набор прокариотических праймеров имеет значительно меньшую систематическую ошибку, чем у большинства ранее применявшихся универсальных праймеров [23], [40].Ранее предполагалось, что наличие единственного несоответствия внутреннего праймера и матрицы в последовательности удлинения праймера может привести к занижению в 1000 раз числа копий гена, что приведет к недопредставлению таксономических групп, которые не соответствуют универсальной последовательности праймера [ 30]. Как описано выше в отношении повышенной скорости обнаружения Verrucomicrobiae и Opitutae , наш универсальный набор прокариотических праймеров идеально соответствовал большему количеству последовательностей гена 16S рРНК в исследованных образцах фекалий, чем бактериальный универсальный праймер, и, следовательно, показал меньшую систематическую ошибку (Таблица 2). ).Однако также возможно, что смещение праймера было связано с присущими свойствами отдельных последовательностей 16S рРНК в исследуемых образцах, включая содержание G + C, число копий и температуру плавления [41] — [43], а также особенности, на которые влияют условия усиления, такие как вторичная структура и стабильность дуплекса. Таким образом, ожидается, что дальнейшая оптимизация условий ПЦР, таких как количество циклов амплификации, концентрации праймеров и геномной ДНК, а также тип и количество полимеразы, дополнительно снизит систематическую ошибку ПЦР.

В заключение, мы разработали универсальный набор прокариотических праймеров, который позволяет проводить одновременный анализ бактерий и архей с ограниченным смещением ПЦР. Процент соответствия недавно разработанного универсального прокариотического праймера для последовательностей в RDP выше, чем у ранее описанных универсальных праймеров, и результаты анализа NGS для образцов фекалий свиней показывают, что этот набор праймеров имеет повышенную чувствительность для членов классов Verrucomicrobiae и Opitutae .Таким образом, ожидается, что при применении к технологии NGS разработанный здесь универсальный набор праймеров для прокариот обеспечит более полное понимание структуры микробного сообщества в образцах окружающей среды с сокращением времени и затрат.

Благодарности

Авторы благодарны доктору К. Ушиде и доктору С. Цучиде, префектурный университет Киото, за их помощь в сборе образцов.

Вклад авторов

Задумал и спроектировал эксперименты: ST TH MN.Проведены опыты: СТ КН. Проанализированы данные: ST JT. Участвовал в написании рукописи: СТ МН.

Ссылки

  1. 1. Перейра и Силва М.К., Диас А.С., ван Эльзас Дж. Д., Саллес Дж. Ф. (2012) Пространственные и временные изменения сообществ архей, бактерий и грибов в сельскохозяйственных почвах. PLoS One 7: e51554.
  2. 2. Тан С., Мадиган М.Т., Ланоил Б. (2013) Разнообразие бактерий и архей в отложениях западного озера Бонни, Сухие долины Мак-Мердо, Антарктида.Appl Environ Microbiol 79: 1034–1038.
  3. 3. Патра А.К., Ю.З. (2012) Влияние эфирных масел на производство и ферментацию метана, а также на численность и разнообразие популяций микробов рубца. Appl Environ Microbiol 78: 4271–4280.
  4. 4. Цумстег А., Лустер Дж., Горанссон Х., Смиттенберг Р.Х., Бруннер И. и др. (2012) Бактериальная, архейная и грибковая сукцессия в переднем поле отступающего ледника. Microb Ecol 63: 552–564.
  5. 5. Winter C, Matthews B, Suttle CA (2013) Влияние изменений окружающей среды и пространственного расстояния на бактерий , архей и вирусы в субполярных и арктических водах.ISME J 7: 1507–1518.
  6. 6. Braker G, Ayala-del-Rio HL, Devol AH, Fesefeldt A, Tiedje JM (2001) Структура сообщества денитрификаторов, бактерий и Archaea вдоль окислительно-восстановительных градиентов в морских отложениях северо-запада Тихого океана с помощью анализа полиморфизма длины конечных рестрикционных фрагментов амплифицированные гены нитритредуктазы ( nirS ) и 16S рРНК. Appl Environ Microbiol 67: 1893–1901.
  7. 7. Zoetendal EG, Collier CT, Koike S, Mackie RI, Gaskins HR (2004) Молекулярно-экологический анализ микробиоты желудочно-кишечного тракта: обзор.J Nutr 134: 465–472.
  8. 8. Han M, Liu F, Zhang F, Li Z, Lin H (2012) Бактериальные и архейные симбионты в губке Южно-Китайского моря Phakellia fusca : структура сообщества, относительная численность и популяции, окисляющие аммиак. Мар Биотехнология 14: 701–713.
  9. 9. Накаяма Дж., Танака С., Сонгджинда П., Татэяма А., Цубучи М. и др. (2007) Анализ кишечной микробиоты младенцев с помощью различных молекулярных подходов: к крупномасштабным эпидемиологическим исследованиям, коррелирующим развитие аллергии с кишечной микробиотой.J Intestinal Microbiol 21: 129–142.
  10. 10. Кертис Т.П., Хед И.М., Ланн М., Вудкок С., Шлосс П.Д. и др. (2006) Какова степень прокариотического разнообразия? Философия Trans R Soc Lond B Biol Sci 361: 2023–2037.
  11. 11. Caporaso JG, Paszkiewicz K, Field D, Knight R, Gilbert JA (2012) Западный Ла-Манш содержит устойчивый банк семян микробов. ISME J 6: 1089–1093.
  12. 12. Fouts DE, Szpakowski S, Purushe J, Torralba M, Waterman RC, et al.(2012) Секвенирование следующего поколения для определения разнообразия прокариот и грибов в рубце крупного рогатого скота. PLoS One 7: e48289.
  13. 13. Киёхара М., Коянаги Т., Мацуи Х., Ямамото К., Таке Х. и др. (2012) Изменения в популяции микробиоты во время ферментации narezushi , выявленные с помощью анализа пиросеквенирования. Биологические науки, биотехнология и биохимия 76: 48–52.
  14. 14. Пинто А.Дж., Раскин Л. (2012) Смещения ПЦР искажают структуру бактериального и архейного сообщества в наборах данных пиросеквенирования.PLoS One 7: e43093.
  15. 15. Йерго Э., Лоуренс Дж. Р., Саншагрин С., Вайзер М. Дж., Корбер Д. Р. и др. (2012) Секвенирование следующего поколения микробных сообществ в реке Атабаска и ее притоках в связи с разработкой нефтеносных песков. Appl Environ Microbiol 78: 7626–7637.
  16. 16. Шокралла С., Спалл Дж. Л., Гибсон Дж. Ф., Хаджибабаей М. (2012) Технологии секвенирования нового поколения для исследования ДНК в окружающей среде. Мол Экол 21: 1794–1805.
  17. 17. Перепел М.А., Смит М., Коупленд П., Отто Т.Д., Харрис С.Р. и др.(2012) Рассказ о трех платформах секвенирования следующего поколения: сравнение секвенсоров Ion Torrent, Pacific Biosciences и Illumina MiSeq. BMC Genomics 13: 341.
  18. 18. Kozich JJ, Westcott SL, Baxter NT, Highlander SK, Schloss PD (2013) Разработка стратегии двухиндексного секвенирования и конвейера курирования для анализа данных последовательности ампликонов на платформе секвенирования MiSeq Illumina. Appl Environ Microbiol 79: 5112–5120.
  19. 19. Ван Кью, Гаррити Дж. М., Тидже Дж. М., Коул Дж. Р. (2007) Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии.Appl Environ Microbiol 73: 5261–5267.
  20. 20. Bowman JS, Rasmussen S, Blom N, Deming JW, Rysgaard S и др. (2011) Структура микробного сообщества арктического многолетнего морского льда и поверхностной морской воды по данным 454 секвенирования гена 16S РНК. ISME J 6: 11–20.
  21. 21. Эйлерс К.Г., Дебенпорт С., Андерсон С., Фирер Н. (2012) Копаем глубже, чтобы найти уникальные микробные сообщества: сильное влияние глубины на структуру сообществ бактерий и архей в почве. Биология и биохимия почвы 50: 58–65.
  22. 22. Сюй Й., Мозер С., Аль-Суд В.А., Соренсен С., Хойби Н. и др. (2012) Культурально-зависимые и независимые исследования микробного разнообразия на мочевых катетерах. J Clin Microbiol 50: 3901–3908.
  23. 23. Takai K, Horikoshi K (2000) Быстрое обнаружение и количественная оценка членов сообщества архей с помощью количественной ПЦР с использованием флуорогенных зондов. Appl Environ Microbiol 66: 5066–5072.
  24. 24. Herlemann DP, Labrenz M, Jurgens K, Bertilsson S, Waniek JJ и др.(2011) Переходы в бактериальных сообществах вдоль градиента солености Балтийского моря 2000 км. ISME J 5: 1571–1579.
  25. 25. Томпсон Дж. Д., Хиггинс Д. Г., Гибсон Т. Дж. (1994) CLUSTAL W: повышение чувствительности последовательного прогрессивного множественного выравнивания последовательностей за счет взвешивания последовательностей, штрафов за пропуски для конкретных позиций и выбора матрицы весов. Nucleic Acids Res 22: 4673–4680.
  26. 26. Накаяма Дж. (2010) Профилирование 16S рРНК желудочно-кишечной микробиоты на основе пиросеквенирования.Биологическая микрофлора 29: 83–96.
  27. 27. Майдак Б.Л., Коул Дж. Р., Лилберн Т. Г., Паркер К. Т. младший, Саксман П. Р. и др. (2001) RDP-II (Проект базы данных рибосом). Nucleic Acids Res 29: 173–174.
  28. 28. Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS (1991) ПЦР «Touchdown» для обхода ложного прайминга во время амплификации гена. Nucleic Acids Res 19: 4008.
  29. 29. Уилан Дж. А., Рассел Н. Б., Уилан М. А. (2003) Метод абсолютного количественного определения кДНК с использованием ПЦР в реальном времени.J Immunol Methods 278: 261–269.
  30. 30. Bru D, Martin-Laurent F, Philippot L (2008) Количественная оценка пагубного эффекта несоответствия одного праймера и матрицы с помощью ПЦР в реальном времени с использованием гена 16S рРНК в качестве примера. Appl Environ Microbiol 74: 1660–1663.
  31. 31. Клиндворт А., Прюсс Э., Швир Т., Пеплис Дж., Кваст С. и др. (2013) Оценка общих праймеров для ПЦР гена 16S рибосомной РНК для классических исследований разнообразия на основе секвенирования и исследований следующего поколения.Нуклеиновые кислоты Res 41: e1.
  32. 32. Wu JH, Hong PY, Liu W.T. (2009) Количественные эффекты положения и типа одиночного несоответствия на удлинение праймера одиночного основания. J Microbiol Methods 77: 267–275.
  33. 33. Fredriksson NJ, Hermansson M, Wilén B-M (2013) Выбор праймеров для ПЦР имеет большое влияние на оценки разнообразия и динамики бактериального сообщества на очистных сооружениях. PLoS ONE 8: e76431.
  34. 34. Лезер Т.Д., Аменувор Дж. З., Дженсен Т. К., Линдекрона Р. Х., Бой М. и др.(2002) Независимый от культуры анализ кишечных бактерий: новый взгляд на микробиоту желудочно-кишечного тракта свиней. Appl Environ Microbiol 68: 673–690.
  35. 35. Snell-Castro R, Godon JJ, Delgenès JP, Dabert P (2005) Характеристика микробного разнообразия в яме для хранения свиного навоза с использованием анализа последовательности малых субъединиц рДНК. FEMS Microbiol Ecol 52: 229–242.
  36. 36. Лю Ф, Ван С., Чжан Дж, Чжан Дж, Ян Х и др. (2009) Структура сообщества бактерий и архей в биогазовом реакторе, выявленная с помощью денатурирующего градиентного гель-электрофореза и анализа секвенирования 16S рДНК.J Appl Microbiol 106: 952–966.
  37. 37. Вреде С., Драйер А., Кокошка С., Хопперт М. (2012) Археи в симбиозах. Archaea 2012: 596846.
  38. 38. Bäckhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI (2005) Бактериальный мутуализм хозяина в кишечнике человека. Наука 307: 1915–1920.
  39. 39. Nehmé B., Gilbert Y, Létourneau V, Forster RJ, Veillette M, et al. (2009) Культурно-независимая характеристика биоразнообразия архей в биоаэрозолях зданий свиней.Appl Environ Microbiol 75: 5445–5450.
  40. 40. Yu Y, Lee C, Kim J, Hwang S (2005) Группоспецифичные наборы праймеров и зондов для обнаружения метаногенных сообществ с использованием количественной полимеразной цепной реакции в реальном времени. Biotechnol Bioeng 89: 670–679.
  41. 41. Фаррелли В., Рейни Ф.А., Стакебрандт Э. (1995) Влияние размера генома и числа копий гена ррн на ПЦР-амплификацию генов 16S рРНК из смеси видов бактерий. Appl Environ Microbiol 61: 2798–2801.
  42. 42. Fogel G, Collins C, Li J, Brunk C (1999) Размер прокариотического генома и количество копий рДНК SSU: оценка относительной численности микробов в смешанной популяции. Микробная экология 38: 93–113.
  43. 43. Исии К., Фукуи М. (2001) Оптимизация температуры отжига для уменьшения систематической ошибки, вызванной несоответствием праймеров в ПЦР с несколькими планшетами. Appl Environ Microbiol 67: 3753–3755.
  44. 44. Muyzer G, de Waal EC, Uitterlinden AG (1993) Профилирование сложных микробных популяций с помощью анализа денатурирующего градиентного гель-электрофореза генов, амплифицированных полимеразной цепной реакцией, кодирующих 16S рРНК.Appl Environ Microbiol 59: 695–700.
  45. 45. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Lozupone CA и др. (2011) Глобальные паттерны разнообразия 16S рРНК на глубине миллионов последовательностей на образец. Proc Natl Acad Sci U S A 108 Suppl 14516–4522.
  46. 46. Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989) Выделение и прямое полное определение нуклеотидов целых генов. Характеристика гена, кодирующего рибосомную РНК 16S. Nucleic Acids Res 17: 7843–7853.
  47. 47. Рейзенбах А.Л., Викхэм Г.С., Пейс Н.Р. (1994) Филогенетический анализ сообщества гипертермофильных розовых нитей в Octopus Spring, Йеллоустонский национальный парк. Appl Environ Microbiol 60: 2113–2119.
  48. 48. Raskin L, Stromley JM, Rittmann BE, Stahl DA (1994) Зонды гибридизации 16S рРНК, специфичные для группы, для описания природных сообществ метаногенов. Appl Environ Microbiol 60: 1232–1240.
  49. 49. Делонг Э. Ф. (1992) Археи в прибрежных морских средах.Proc Natl Acad Sci U S A 89: 5685–5689.
.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *